Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panthera tigris sumatrae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGCTGACTATTTTCAACCAATCACAAGGATATTGGAACTCTTTACCTTTTATTTGGCGCCTGGGCTGGTATGGTGGGGACTGCCCTCAGTCTCCTAATTCGAGCCGAACTGGGTCAACCTGGCACACTACTAGGAGATGACCAAATTTATAATGTGGTAGTTACTGCCCATGCCTTTGTGATAATCTTTTTTATAGTAATGCCTATTATAATTGGAGGATTCGGAAACTGGCTAGTTCCGTTAATAATCGGAGCCCCCGATATGGCATTCCCTCGAATGAATAACATAAGCTTCTGACTCCTTCCCCCATCCTTCCTACTTCTGCTCGCATCGTCTATGGTAGAAGCTGGGGCAGGGACTGGGTGGACAGTATACCCACCCCTAGCTGGCAACCTAGCCCATGCAGGAGCATCCGTGGATCTAACTATTTTTTCACTACACCTAGCAGGCGTCTCCTCAATCTTAGGTGCTATTAATTTTATTACTACTATTATTAATATAAAACCGCCCGCTATGTCCCAATACCAAACACCCCTGTTTGTTTGATCGGTTCTAATTACTGCTGTGTTGCTACTTCTATCACTGCCAGTTTTAGCAGCAGGCATCACCATGCTACTGACAGATCGAAATCTAAATACCACATTTTTTGATCCTGCCGGGGGAGGAGACCCCATCTTATATCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTATATCTTAATCCTGCCCGGGTTTGGAATAATTTCACATATTGTCACCTACTACTCAGGCAAAAAAGAACCTTTTGGCTACATGGGGATAGTCTGAGCCATAATGTCAATTGGCTTTCTGGGCTTTATCGTATGGGCCCATCACATGTTTACTGTAGGGATAGATGTGGATACACGAGCATACTTTACGTCAGCTACTATAATTATCGCTATTCCTACTGGGGTAAAAGTATTTAGCTGATTGGCCACTCTTCACGGGGGTAATATTAAATGGTCTCCCGCTATACTATGGGCTTTGGGATTCATTTTCCTATTCACCGTAGGGGGCTTAACAGGAATTGTATTAGCAAACTCCTCATTGGATATTGTCCTTCACGACACATACTACGTAGTAGCCCACTTCCACTACGTCTTGTCAATAGGAGCAGTATTTGCTATCATAGGGGGCTTCGTTCACTGATTCCCCTTATTCTCAGGGTATACTCTTGATAATACTTGGGCAAAAGTTCATTTTACGATCATGTTCGTAGGTGTCAATATAACGTTTTTCCCTCAGCATTTCCTAGGCCTGTCTGGGATGCCTCGACGTTATTCTGACTATCCAGACGCGTATACAACTTGAAACACAATCTCCTCAATAGGCTCTTTTATTTCACTAACAGCAGTAATATTAATAGTCTTTATAGTGTGAGAAGCTTTCGCATCAAAGCGAGAAGTAGCCACAGTGGAACTAACCACAACTAATCTCGAATGACTTCACGGATGTCCTCCTCCGTATCACACATTTGAAGAGCCAGCCTACGTGCTGTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panthera tigris sumatrae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Linkie, M., Wibisono, H.T., Martyr, D.J. & Sunarto, S.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. (Cat Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
The Sumatran Tiger occurs in about 58,321 km² of forested habitat in 12 potentially isolated Tiger Conservation Landscapes totalling 88,351 km² (Sanderson et al. 2006), with about 37,000 km² protected in ten national parks (Govt of Indonesia 2007). The tiger population was estimated at 400-500 in the first and second national tiger action plans (Govt of Indonesia 1994, 2007a), and at 342-509 in six major protected areas (estimates from Shepherd and Magnus 2004). However, incorporating more recent research, covering most of tiger estimated habitat (Sanderson et al. 2006) suggests the population could be higher (see Table 1 in attached PDF).

There is no recent information from Berbak or Gunung Leuser, and both of these estimates are considered speculative. Completion of a research in the three Tiger Conservation Landscapes in Riau province by Sunarto et al. (2007) will improve efforts to assess the Sumatran Tiger population.

IUCN Guidelines (IUCN 2006) define population as the number of mature individuals, defined as “individuals known, estimated or inferred to be capable of reproduction.” While in general this refers to all reproductive-age adults in the population, the Guidelines also “stress that the intention of the definition of mature individuals is to allow the estimate of the number of mature individuals to take account of all the factors that may make a taxon more vulnerable than otherwise might be expected.” Two factors which increase the tiger's vulnerability to extinction are their low densities (relative to other mammals, including their prey species) and relatively low recruitment rates (where few animals raise offspring which survive to join the breeding population) (Smith and McDougal 1991, Kerley et al. 2003). Low densities means that relatively large areas are required for conservation of viable populations; it has long been recognized that many protected areas are too small to conserve viable tiger populations (Nowell and Jackson 1996, Dinerstein et al. 1997, Sanderson et al. 2006). Low recruitment rates also require larger populations and larger areas to conserve viable populations, as well as mortality reduction in non-protected areas to maintain population size through connectivity (Carroll and Miquelle 2006). High mortality rates can be offset by an abundant prey base (Karanth et al. 2006), but prey base depletion was considered a leading threat to tigers across much of their range (Sanderson et al. 2006). The IUCN Guidelines advise that “mature individuals that will never produce new recruits should not be counted.” Low recruitment rates indicate that fewer adults than would be expected produce new recruits. Defining population size as the total estimated number of reproductive age adults in the taxon would also not take into account that many occur in subpopulations which are too small or too threatened for long-term viability. Instead, the number of mature individuals is defined as equivalent to the estimated effective population size.

Effective population size (Ne) is an estimator of the genetic size of the population, and is generally considered representative of the proportion of the total adult population (N) which reproduces itself through offspring which themselves survive and reproduce. Ne is usually smaller than N, as has been documented for the tiger. The effective population size of tigers in Nepal’s Chitwan National Park was equivalent to just 40% of the actual adult population (Smith and McDougal 1991). Therefore, the number of viable mature Sumatran tigers is projected to be 40% of the total estimated population, in the range of 176–271 (based on the detailed figures given above), with no subpopulation having an effective population size larger than 50, following the precautionary principle in selecting the lower bound subpopulation sizes for Kerinci Seblat, Gunung Leuser and Bukit Tigapuluh.

The Sumatran Tiger is declining due to high rates of habitat loss (3.2–5.9%/yr; Achard et al. 2002, FWI/GFW 2001, Uryu et al. 2007) and fragmentation, which also occur, to a lesser extent, inside protected areas (Gaveau et al. 2007, Kinnaird et al. 2003, Linkie et al. 2003, 2004, 2006). There are high levels of human-tiger conflict (Nyhus and Tilson 2004, Browne and Martyr 2007), as well as illegal trade in tiger parts (Nowell 2000, Nowell 2007). From 1998-2002 at least 51 tigers per year were killed, with 76% for purposes of trade and 15% out of human-tiger conflict (Shepherd and Magnus 2004). Ng and Nemora (2007) found the parts of at least 23 tigers for sale in market surveys around the island.

History
  • 1996
    Critically Endangered
    (Baillie and Groombridge 1996)
  • 1996
    Critically Endangered
  • 1996
    Critically Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Habitat loss due to expansion of oil palm plantations and planting of Acacia plantations. Illegal trade, primarily for domestic market. Prey-base depletion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sumatran tiger

The Sumatran tiger (Panthera tigris sumatrae) is a rare tiger subspecies that inhabits the Indonesian island of Sumatra. It was classified as critically endangered by IUCN in 2008 as the population was estimated at 441 to 679 individuals, with no subpopulation larger than 50 individuals and a declining trend.[1]

The Sumatran tiger is the only surviving member of the Sunda Islands group of tigers that included the now extinct Bali tiger and Javan tiger.[2] Sequences from complete mitochondrial genes of 34 tigers support the hypothesis that Sumatran tigers are diagnostically distinct from mainland populations.[3]

Characteristics[edit]

Sumatran tiger in the Melbourne Zoo

Pocock first described the Sumatran tiger on the basis of several skull, pelage and striping features in which it is distinct from the Indian and Javan tigers. It is darker in fur colour and has thicker stripes than the Javan tiger.[4] Stripes tend to disintegrate into spots near their ends, and lines of small dark specks between regular stripes may be found on the back, flanks and hind legs.[5] The frequency of stripes is higher than in other subspecies.[6]

Males have a prominent ruff, which is especially marked in the Sumatran tiger.[7]

The Sumatran tiger is one of the smallest tiger subspecies. Males weigh 100 to 140 kg (220 to 310 lb) and measure 220 to 225 cm (87 to 89 in) in length between the pegs with a greatest length of skull of 295 to 335 mm (11.6 to 13.2 in). Females weigh 75 to 110 kg (165 to 243 lb) and measure 215 to 230 cm (85 to 91 in) in length between the pegs with a greatest length of skull of 263 to 294 mm (10.4 to 11.6 in).[5]

Distribution and habitat[edit]

Sumatran tigers persist in isolated populations across Sumatra.[8] They occupy a wide array of habitats, ranging from 0 m above sea level in the coastal lowland forest of Bukit Barisan Selatan National Park on the southeastern tip of Lampung Province to 3,200 m (10,500 ft) in mountain forests of Gunung Leuser National Park in Aceh Province. They have been repeatedly photographed at 2,600 m (8,500 ft) in a rugged region of northern Sumatra, and are present in 27 habitat patches larger than 250 km2 (97 sq mi).[9]

In 1978, the Sumatran tiger population was estimated at 1000 individuals, based on responses to a questionnaire survey.[10] In 1985, a total of 26 protected areas across Sumatra containing approximately 800 tigers were identified.[11] In 1992, it was estimated that 400–500 tigers lived in five national parks and 2 protected areas.[12] At the time, the largest population was reported from the Gunung Leuser National Park as comprising 110 to 180 individuals.[13] However, a more recent study shows that the Kerinci Seblat National Park in central Sumatra has the highest population of tigers on the island, estimated to be at 165–190 individuals. The park also was shown to have the highest tiger occupancy rate of the protected areas, with 83% of the park showing signs of tigers.[14] In fact, there are more tigers in the Kerinci Seblat National Park than in all of Nepal, and more than in China, Laos, Cambodia, and Vietnam combined.[15][16]

Ecology and behaviour[edit]

Sumatran tigers strongly prefer forest and use plantations of acacia and oil palm far less than their availability. Within natural forest areas they tend to use areas with higher elevation, lower annual rainfall, farther from forest edge, and closer to forest centres. They prefer forest with dense understory cover and steep slope, and they strongly avoid forest areas with high human influence in the forms of encroachment and settlement. In acacia plantations they tend to use areas closer to water, and prefer areas with older plants, more leaf litter and thicker sub-canopy cover. They avoid areas with high human activity. Tiger records in oil palm plantations and in rubber plantations are scarce. The availability of adequate vegetation cover at the ground level serves as an environmental condition fundamentally needed by tigers regardless of the location. Without adequate understory cover, tigers are even more vulnerable to persecution by humans. Human disturbance related variables negatively affect tiger occupancy and habitat use. Variables with strong impacts include settlement and encroachment within forest areas, logging and the intensity of maintenance in acacia plantations.[17] Camera trapping surveys conducted in southern Riau revealed an extremely low abundance of potential prey and a low tiger density in peat swamp forest areas. Repeated sampling in the newly established Tesso Nilo National Park documented a trend of increasing tiger density from 0.90 individuals per 100 km2 (39 sq mi) in 2005 to 1.70 individuals per 100 km2 (39 sq mi) in 2008.[18]

In the Bukit Barisan Selatan National Park, nine prey species larger than 1 kg (2.2 lb) of body weight were identified including Great Argus Pheasant, Pigtail Macaque, porcupine, Malay tapir, wild pig, Greater and Lesser mouse-deer, muntjac and Sambar deer.[8]

Threats[edit]

Major threats include habitat loss due to expansion of palm oil plantations and planting of acacia plantations, prey-base depletion, and illegal trade primarily for the domestic market.[1]

Tigers need large contiguous forest blocks to thrive.[17] Between 1985 and 1999, forest loss within Bukit Barisan Selatan National Park averaged 2% per year. A total of 661 km2 (255 sq mi) of forest disappeared inside the park, and 318 km2 (123 sq mi) were lost in a 10-km buffer, eliminating forest outside the park. Lowland forest disappeared faster than montane forest, and forests on gentle slopes disappeared faster than forests on steep slopes. Most forest conversion resulted from agricultural development, leading to predictions that by 2010 70% of the park will be in agriculture. Camera-trap data indicated avoidance of forest boundaries by tigers. Classification of forest into core and peripheral forest based on mammal distribution suggests that by 2010, core forest area for tigers will be fragmented and reduced to 20% of remaining forest.[19]

Despite being given full protection in Indonesia and internationally, tiger parts are still found openly in trade in Sumatra. In 2006, surveys were conducted over a seven month period in 28 cities in seven Sumatran provinces and nine seaports. A total of 326 retail outlets were surveyed, and 33 (10%) were found to have tiger parts for sale, including skins, canines, bones and whiskers. Tiger bones demanded the highest average price of US$ 116 per kg, followed by canines. There is evidence that tiger parts are smuggled out of Indonesia. In July 2005, over 140 kg of tiger bones and 24 skulls were confiscated in Taiwan in a shipment from Jakarta.[20]

Conservation[edit]

Panthera tigris is listed on CITES Appendix I. Hunting is prohibited in Indonesia.[7]

In 1994, the Indonesian Sumatran Tiger Conservation Strategy addressed the potential crisis that tigers faced in Sumatra. The Sumatran Tiger Project (STP) was initiated in June 1995 in and around the Way Kambas National Park in order to ensure the long-term viability of wild Sumatran tigers and to accumulate data on tiger life-history characteristics vital for the management of wild populations.[21] By August 1999, the teams of the STP had evaluated 52 sites of potential tiger habitat in Lampung Province, of which only 15 these were intact enough to contain tigers.[22] In the framework of the STP a community-based conservation programme was initiated to document the tiger-human dimension in the park in order to enable conservation authorities to resolve tiger-human conflicts based on a comprehensive database rather than anecdotes and opinions.[23]

In 2007, the Indonesian Forestry Ministry and Safari Park established cooperation with the Australia Zoo for the conservation of Sumatran tigers and other endangered species. The program includes conserving Sumatran tigers and other endangered species in the wild, efforts to reduce conflicts between tigers and humans, and rehabilitating Sumatran Tigers and reintroducing them to their natural habitat. One hectare of 186 hectares of Taman Safari is the world's only Sumatran tiger captive breeding center which has also sperm bank.[24]

An 110,000 acre conservation area and rehabilitation center, Tambling Wildlife Nature Conservation, has been set up on the edge of a national park on the southern tip of Sumatra (Lampung).[25] On October 26, 2011, a tigress who had been captured with an injured leg in early October delivered three male cubs in a temporary cage, while waiting for release after her recovery.[26]

On Feb 3, 2014 three Sumatran tiger cubs were born to a five year old tigress in London Zoo,[27] in the Zoo's Tiger Territory; a £3.6m project to encourage endangered subspecies of tiger to breed.[28]

Evolution[edit]

Analysis of DNA is consistent with the hypothesis that Sumatran tigers have been isolated from other tiger populations after a rise in sea level that occurred at the Pleistocene to Holocene border about 12,000–6,000 years ago. In agreement with this evolutionary history, the Sumatran tiger is genetically isolated from all living mainland tigers, which form a distinct group closely related to each other.[3]

See also[edit]

References[edit]

  1. ^ a b c Linkie, M., Wibisono, H. T., Martyr, D. J., Sunarto, S. (2008). "Panthera tigris ssp. sumatrae". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. 
  2. ^ Mazák, J. H. and Groves, C. P. (2006). "A taxonomic revision of the tigers (Panthera tigris)". Mammalian Biology 71 (5): 268–287. doi:10.1016/j.mambio.2006.02.007. 
  3. ^ a b Cracraft, J., Feinstein, J., Vaughn, J., Helm-Bychowski, K. (1998). "Sorting out tigers (Panthera tigris): Mitochondrial sequences, nuclear inserts, systematics, and conservation genetics". Animal Conservation 1 (2): 139–150. doi:10.1111/j.1469-1795.1998.tb00021.x. 
  4. ^ Pocock, R. I. (1929). Tigers. Journal of the Bombay Natural History Society 33: 505–541.
  5. ^ a b Mazák, V. (1981). "Panthera tigris". Mammalian Species 152 (152): 1–8. doi:10.2307/3504004. 
  6. ^ Kitchener, A. (1999). Tiger distribution, phenotypic variation and conservation issues. Pages 19–39 in: Seidensticker, J., Christie, S., Jackson, P. (eds.) Riding the Tiger. Tiger Conservation in human-dominated landscapes. Cambridge University Press, Cambridge, ISBN 0-521-64057-1.
  7. ^ a b Nowell, K., Jackson, P. (1996). Tiger Panthera tigris (Linnaeus 1758) in: Wild Cats: status survey and conservation action plan. IUCN/SSC Cat Specialist Group, Gland, Switzerland
  8. ^ a b O’Brien, T. G., Kinnard, M. F. and Wibisono, H. T. (2003). "Crouching tigers, hidden prey: Sumatran tiger and prey populations in a tropical forest landscape". Animal Conservation 6 (2): 131–139. doi:10.1017/S1367943003003172. 
  9. ^ Wibisono, H. T. and Pusarini, W. (2010). "Sumatran tiger (Panthera tigris sumatrae): A review of conservation status". Integrative Zoology 5 (4): 313–23. doi:10.1111/j.1749-4877.2010.00219.x. PMID 21392349. 
  10. ^ Borner, M. (1978). "Status and conservation of the Sumatran tiger". Carnivore 1 (1): 97–102. 
  11. ^ Santiapillai, C., Ramono, W. S. (1987). Tiger numbers and habitat evaluation in Indonesia, pp. 85–91 in: Tilson, R. L., Seal, U. S. (eds.) Tigers of the World: The Biology, Biopolitics, Management, and Conservation of an Endangered Species. Noyes Publications, New Jersey, ISBN 0815511337.
  12. ^ Tilson, R. L., Soemarna, K., Ramono, W. S., Lusli, S., Traylor-Holzer, K., Seal, U. S. (1994). Sumatran Tiger Populations and Habitat Viability Analysis. Indonesian Directorate General of Forest Protection and Nature Conservation, and IUCN/SSC Conservation Breeding Specialist Group, Apple Valley.
  13. ^ Griffiths, M. (1994). Population density of Sumatran tigers in Gunung Leuser National Park, pp. 93–102 in: Tilson, R., Soemarna, K., Ramono, W. S., Lusli, S., Traylor-Holzer, K., Seal, U. (eds.) Sumatran Tiger Population and Habitat Viability Analysis Report. Directorate of Forest Protection and Nature Conservation and IUCN/SSC Conservation Breeding Specialist Group, Apple Valley, Minnesota.
  14. ^ Wibisono HT, Linkie M, Guillera-Arroita G, Smith JA, Sunarto, et al. (2011). "Population Status of a Cryptic Top Predator: An Island-Wide Assessment of Tigers in Sumatran Rainforests". In Gratwicke, Brian. PLoS ONE 6 (11): e25931. doi:10.1371/journal.pone.0025931. PMC 3206793. PMID 22087218. 
  15. ^ Road-building Plans Threaten Tigers. Jakarta Post, April 28, 2011.
  16. ^ No humour, not this time – 26th of April 2011. 21stcenturytiger.org
  17. ^ a b Sunarto, S., Kelly, M. J., Parakkasi, K., Klenzendorf, S., Septayuda, E., Kurniawan, H. (2012). "Tigers Need Cover: Multi-Scale Occupancy Study of the Big Cat in Sumatran Forest and Plantation Landscapes". In Gratwicke, Brian. PLoS ONE 7 (1): e30859. doi:10.1371/journal.pone.0030859. 
  18. ^ Sunarto, S. (2011). Ecology and restoration of Sumatran tigers in forest and plantation landscapes. PhD thesis. Blacksburg, USA.
  19. ^ Kinnaird, M. F., Sanderson, E. W., O’Brien, T. G., Wibisono, H., T. and Woolmer, G. (2003). Deforestation trends in a tropical landscape and implications for forest mammals. Conservation Biology 17: 245–257.
  20. ^ Ng, J. and Nemora. (2007). Tiger trade revisited in Sumatra, Indonesia. Traffic Southeast Asia, Petaling Jaya, Malaysia.
  21. ^ Franklin, N., Bastoni, Sriyanto, Siswomartono, D., Manansang, J. and R. Tilson (1999). Last of the Indonesian tigers: a cause for optimism, pp. 130–147 in: Seidensticker, J., Christie, S. and Jackson, P. (eds). Riding the tiger: tiger conservation in human-dominated landscapes. Cambridge University Press, Cambridge, ISBN 0521648351.
  22. ^ Tilson, R. (1999). Sumatran Tiger Project Report No. 17 & 18: July − December 1999. Grant number 1998-0093-059. Indonesian Sumatran Tiger Steering Committee, Jakarta.
  23. ^ Nyhus, P., Sumianto and R. Tilson (1999). The tiger-human dimension in southeast Sumatra, pp. 144–145 in: Seidensticker, J., Christie, S. and Jackson, P. (eds). Riding the tiger: tiger conservation in human-dominated landscapes. Cambridge University Press, Cambridge, ISBN 0521648351.
  24. ^ "Sumatran tiger sperm bank". The Jakarta Post. December 15, 2012. 
  25. ^ "On the prowl for man-eating tigers". November 19, 2010. 
  26. ^ "Tambling Ketambahan Tiga Anak Harimau". mediaindonesia.com. November 1, 2011. 
  27. ^ [1]
  28. ^ [2]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!