Overview

Brief Summary

Biology

The rufous hare wallaby is a solitary and nocturnal animal (5). It has a stomach that is well adapted to a high plant-fibre diet and so is able to feed on seedheads, young sedges, grass leaves, herbs and shrubs, favouring vegetation that is regenerating after a fire (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The rufous hare wallaby's genus name, Lagorchestes, means 'dancing hare' and to some extent these wallabies do resemble hares in their size, appearance, movement and habits (4). However, like all wallabies, they have much larger hind legs than hares, and considerably smaller forelimbs, a long thin tail and a narrower hunched upper body (5). This marsupial does move around on all fours, but if it needs to move quickly it raises itself onto its muscular back legs and hops. Its thick fur is brown to grey in colour, with darker paws, feet and tail, and a lighter front. The rufous wallaby has large beady black eyes, fairly large pointed ears and a small naked nose with short whiskers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Rufous Hare-wallaby was formerly found throughout spinifex deserts of central Northern Territory and Western Australia and north-western parts of South Australia. There are four recognised taxa:

Lagorchetes hirsutus hirsutus formerly occurred only in the south-west of Western Australia. It is extinct.

L. h. bernieri is restricted to Bernier Island, Western Australia.

L. h. dorreae is restricted to Dorre Island, Western Australia. Whether there are separate subspecies on Bernier and Dorre Islands is a moot point; Western Australian scientists do not recognise two subspecies for the purposes of listing, bernier is considered to have priority (A. Burbidge pers. comm.).

An unnamed subspecies of L. hirsutus from the Tanami Desert on the Australian mainland is now limited to captive colonies and as experimental reintroduction/translocation programs (Maxwell et al. 1996). This undescribed subspecies was once widespread in central Australian deserts. Captive colonies of this subspecies exist in Dryandra Conservation Reserve (south-east of Perth) and at Shark Bay. There is also a colony on Trimouille Island (520 hectares), Western Australia as a consequence of a translocation from the Tanami Desert to that site in 1998; the subspecies now ranges throughout the island (Langford and Burbidge 2001; Johnson and Burbidge 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Rufous hare-wallabies historically had a widespread distribution throughout the arid and semi-arid parts of western Australia and southern Northern Territory until the 1930’s. Currently, they are only found on the islands of Dorre and Bernier in Shark Bay off the coast of Western Australia. They occur throughout each island, but are more abundant in the southern ends of both. A few small populations exist on the mainland in captive settings and in experimental reintroduction sites in the Tanami Desert and southern Shark Bay. Small wild populations did exist in the Tanami Desert, Northern Territory; however, bush fires and introduced red fox (Vulpes vulpes) predation wiped them out in the 1990’s.

Biogeographic Regions: australian (Native )

  • Wildscreen. 2006. "ARKive" (On-line). Accessed October 15, 2006 at http://www.arkive.org/species/GES/mammals/Lagorchestes_hirsutus/more_info.html.
  • 2006. "Australian Wildlife Conservancy" (On-line). Accessed November 06, 2006 at http://www.australianwildlife.org/wildlifeprofiles.asp?WID=571.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

In the 19th Century this species occured across 25% of Australia, but by 1990 there was only one small mainland area where they could be found, and this population comprised of only 30 individuals (5). Sadly, this whole population was wiped out by a bush fire in the 1990s. At present, this species is only found on Bernier Island and Dorre Island off the coast of western Australia, and on the mainland in two experimental reintroduction sites (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The name Lagorchestes means “dancing hare.” Hare-wallabies do resemble hares in appearance and behavior. However, like all wallabies, they have larger hind legs than hares, a thinner, hunched body, smaller forelimbs, and a long, thin tail. They are both quadripedal and bipedal, hopping on strong hind legs or maneuvering on all fours. Their fur is long, soft, and thick. Their ventrum and hindquarters are a sandy, buff color while the back and head are grey-rufous. They have long pointed ears, large black eyes, short whiskers, and darker colored paws. The species name hirsutus refers to the fact that their fur gets longer towards their back, giving them a shaggy appearance.

Males and females are identical in color, with females generally being larger in size. Females range from 0.78 to 1.9 kg while males range from 1.24 to 1.8 kg. The length from tip of nose to base of tail for females is 36 to 39 cm, and tail length is 24 to 30.5 cm. Male head/body length is 31 to 36 cm, and tail length is 26 to 27 cm. They both stand roughly 30 cm high.

There are four recognized sub-species, L. h. bernieri, L. h. dorreae, L. h. hirsutus, and an unnamed subspecies. Lagorchestes hirsutus bernieri is the Bernier Island sub-species, it has noticeably paler fur and shorter ears. Lagorchestes hirsutus dorreae is the Dorre Island sub-species, its fur is far redder than the mainland species and its skull is narrower between the orbits. Lagorchestes hirsutus hirsutus is extinct, and the unnamed subspecies is extinct in the wild and critically endangered.

Range mass: 0.78 to 1.9 kg.

Range length: 31 to 39 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • Lundie-Jenkins, G. 1993. Reproduction and growth to sexual maturity in the Rufous Harewallaby Lagorchestes hirsutus Gould (Macropodidae: Marsupialia) in captivity. Australian Mammalogy, 16: 45-49.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The mainland habitat was mainly in spinifex (Triodia spp.) hummock grasslands of the central deserts (Northern Territory, Western Australia, and South Australia). Tanami Desert colonies formerly associated with saline palaeo-drainage system, sand dunes, and tight fire patterns. Large areas of spinifex desert appear suitable provided that exotic predators and rabbits are at low densities or controlled and fire is properly managed (Maxwell et al. 1996).

The species typically carries a single young, usually two per year, with a pouch life of approximately four months (J. Richards pers. comm.). The species can survive up to five years in captivity (Langford and Burbidge 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Mainland habitats for rufous hare-wallabies were primarily in the Tanami Desert, which has a warm, dry monsoonal climate and is semi-arid. Drought is a common feature which makes rainfall the main factor in primary productivity. In comparison, current island habitats have a warm, dry Mediterranean climate.

Rufous hare-wallabies required mosaics of burnt and unburnt patches of spinifex grassland to survive in the Tanami Desert. The dominant species are mature Triodia pungens and Plectrachne schinzii. The various stages of fire succession, and the ecotones they created, provided adequate shelter and food supply. Patchiness, degree of senescence, diversity of food and vegetation, hummock size, and habitat structure were important factors influencing suitable and unsuitable areas. The degree of connectivity and accessibility of each of these aspects was important as well.

Bernier and Dorre islands have four main types of habitat: sand plain (Triodia species) grasslands, sand plain heath, consolidated dunes, unconsolidated dune/beach, and travertine heath. Rufous hare-wallabies occur throughout these habitats, but favor consolidated dunes, beaches, and both heath habitats. They shelter in scrapes, often under Triodia plurinervata or Thryptomene micrantha, or in single opening burrows. They will run out and escape in a zig zag pattern if flushed.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland

  • Dept. of Conservation and Land Management. 2006. "Rufous Hare-Wallaby or Mala" (On-line). NatureBase. Accessed October 20, 2006 at http://www.calm.wa.gov.au/plants_animals/pdf_files/sp_mala.pdf.
  • Langford, D. 2006. "The Mala (Lagorchestes hirsutus) Recovery Plan" (On-line). Accessed November 12, 2006 at http://www.deh.gov.au/biodiversity/threatened/publications/recovery/mala/index.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This shy marsupial inhabits arid and semi-arid environments, particularly grasslands of the sand plain and sand dune deserts (2). Studies have shown that the rufous hare wallaby is fairly mobile, but is largely absent from large areas of old spinifex grassland, preferring mosaics of un-burnt areas and habitats that are regenerating after fires. The island populations occur in hummock grasslands and sand plain heath (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Rufous hare-wallabies are granivorous and herbivorous. They eat mainly seeds, fruits, grasses, sedges, and succulent shrubs and herbs. They alter their feeding habits and diet in response to changes in their environment, primarily seasonal changes in rainfall.

Monocots are their staple diet (44 to 65%), along with seeds and succulent fruits when they are available. Rufous hare-wallabies prefer the stems and leaves of perennial grasses such as Eragrostis falcata, E. speciosa and Aristida browniana, and the seeds from T. pungens, E. falcata, and Aristida holathera. The plant material of T. pungens was avoided unless conditions were very poor. Leaves and stems from sedges like Cyperus conicus, C. bulbosus, C. concinnus, Fimbristylis caespitosa, and Bulbostylis species were a less favored alternative, comprising 15 to 32% of the diet.

Dicots, hardy perennials, and occasional insects are chosen in drier, poorer conditions. The plant material of Goodenia virgata, Neobassia astrocarpa, and Stackhousia intermedia, and the seeds and fruit of Cassytha filiformis were extensively used as a secondary diet. They are flexible enough to utilize the nectar rich flowers of Grevillea juncifolia if necessary.

Animal Foods: insects

Plant Foods: leaves; wood, bark, or stems; seeds, grains, and nuts; fruit; nectar

Primary Diet: herbivore (Folivore , Granivore )

  • Lundie-Jenkins, G. 1993. Ecology of the rufous hare-wallaby, Lagorchestes hirsutus Gould (Marsupialia: Macropodidae) in the Tanami Desert, Northern Territory. II. Diet and feeding strategy. Wildlife Research, 20: 477-494.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Rufous hare-wallabies are herbivores, feeding on a wide variety of plant species, and may play a role in altering the distribution and abundance of such species by grazing, browsing, and digging burrows. There is competition between hare wallabies and introduced rabbits (Oryctolagus cuniculus) because of similar size, metabolic requirements, and overlaps in habitat and diet. Diet overlap and competition is highest when conditions are poorest. Rufous hare-wallabies are also prey to co-occurring carnivores, such as dingos, red foxes, and domestic cats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The sandy buff and grey-rufous pelt colorations of rufous hare-wallabies allows them to blend in well with their arid, desert like climates. Short burrows, with an average length of 105 m and depth of 30 m, are dug for protection from heat and predators during the day. They also shelter in small scrapes hidden by spinifex clumps or other bushes.  The major threat to Lagorchestes hirsutus comes from feral cats and introduced red foxes. Dingos (Canis familiaris dingo) prey on these wallabies, but to a lesser extent.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Rufous hare-wallabies primarily use body language and vocalizations to communicate with each other. They are generally non-aggressive and avoid confrontation. Two females will often sniff each other then leave, a male may mark his territory by spraying a tree with urine, alarmed wallabies will give a loud squeak and then hiss as they run for cover. Even though they are nocturnal, they can still use posture and movements for visual communication, especially during female and male interaction.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little known about lifespan in rufous hare-wallabies.

Average lifespan

Status: captivity:
13.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.2 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Rufous hare-wallabies are solitary creatures. When they meet, a male will sexually inspect a female. If she is unresponsive, she will move away or kick. Responsive females will lay prone and accept mating. In the wild, males may guard their mates, and often times a single ovulating female will attract many males, giving rise to a mating chase. In captivity, lack of additional males in the pen and limited space remove the necessity for mate defense. Future research needs to be done on effectiveness of mate guarding and length of female receptivity in the wild.

Mating System: polygynous

Like other macropodids, rufous hare-wallabies exhibit embryonic diapause. This allows the female to decrease the interval between litters if conditions are favorable and food is plentiful, or put an embryo on hold, or even abort, if a drought occurs. This is exceedingly important in the unstable environments most hare-wallabies live in. There is no evidence that lactating female wallabies occupy different habitats while pregnant so they are just as susceptible to changes in food availability and nutritional content.

Rufous hare-wallabies are receptive at, or slightly before, the time when they wean their young in the pouch. This, combined with their relatively short gestation and shortened pouch-life (124 days), allows them to have up to three offspring per year. They are monovular and polyestrous.

Time to weaning is 5 months and females can be sexually mature anywhere from 5 to 23 months old. Males are sexually mature at 14 to 20 months.

Breeding interval: In captivity, rufous hare-wallabies breed continuously throughout the year.

Breeding season: Rufous hare-wallabies in captive settings have no set breeding season- they breed year round. In the wild however, most successful births coincide with months of heavy rainfall, when more high quality food is available.

Average number of offspring: 1.

Average weaning age: 124 days.

Range age at sexual or reproductive maturity (female): 5 to 23 months.

Range age at sexual or reproductive maturity (male): 14 to 20 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; embryonic diapause

Average number of offspring: 1.

Females care for, feed, and protect the young. Once weaned, mothers and other mature adults often act aggressively towards juveniles. This causes the juvenile to disperse, decreasing the chances of inbreeding and reducing local competition for scarce resources.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Lundie-Jenkins, G. 1993. Reproduction and growth to sexual maturity in the Rufous Harewallaby Lagorchestes hirsutus Gould (Macropodidae: Marsupialia) in captivity. Australian Mammalogy, 16: 45-49.
  • Dept. of Conservation and Land Management. 2006. "Rufous Hare-Wallaby or Mala" (On-line). NatureBase. Accessed October 20, 2006 at http://www.calm.wa.gov.au/plants_animals/pdf_files/sp_mala.pdf.
  • Langford, D. 2006. "The Mala (Lagorchestes hirsutus) Recovery Plan" (On-line). Accessed November 12, 2006 at http://www.deh.gov.au/biodiversity/threatened/publications/recovery/mala/index.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lagorchestes hirsutus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0672-06|NC_008136|Lagorchestes hirsutus| ACCCGTTGATTATTTTCAACCAATCACAAAGATATTGGTACGCTATACTTGCTATTCGGCGCTTGAGCAGGAATAGTGGGGACTGCCTTA---AGCTTACTTATTCGAGCAGAACTCGGTCAACCTGGAACCCTAATTGGAGAT---GATCAAATTTATAACGTTATTGTCACTGCTCATGCCTTCGTAATAATTTTCTTTATGGTAATGCCTATTATAATTGGAGGCTTCGGCAACTGACTAGTACCTTTAATA---ATTGGAGCACCCGATATAGCATTCCCCCGAATGAATAACATAAGTTTCTGACTTCTACCACCATCTTTCCTTCTTCTATTGGCATCCTCTACAGTAGAAGCAGGGGCAGGGACAGGATGGACTGTATACCCCCCATTAGCTGGAAATCTAGCTCACGCTGGAGCTTCTGTAGACTTA---GCCATTTTCTCCCTTCACCTAGCAGGAGTATCATCCATCCTAGGAGCAATTAACTTCATTACCACTATTATTAACATAAAACCACCAGCCTTATCTCAATATCAAACCCCACTGTTCGTTTGATCCGTAATAATCACAGCAGTCCTACTCCTCCTTTCACTACCAGTATTAGCAGCT---GGCATTACAATACTTCTAACAGACCGAAACCTAAATACAACATTCTTCGATCCTGCTGGAGGTGGAGACCCAATCCTATACCAACATCTCTTTTGATTCTTTGGCCACCCAGAAGTCTATATTCTAATTCTCCCAGGGTTTGGCATAATCTCACATATTGTAACCTACTACTCCGGTAAAAAA---GAACCTTTCGGCTATATAGGCATGGTTTGAGCTATAATATCCATTGGATTCCTAGGCTTTATCGTTTGAGCCCACCATATATTCACAGTAGGACTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lagorchestes hirsutus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
D2

Version
3.1

Year Assessed
2008

Assessor/s
Richards, J., Morris, K., Friend, T. & Burbidge, A.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Vulnerable as there is a restricted area of occupancy, which includes less than five locations that are each easily susceptible to either a large fire event or to elimination by introduced predators.

History
  • 1996
    Vulnerable
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Rare
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Small yearly fires by aborigines promoted regeneration of plants fed upon by hare wallabies and created a patchwork of habitats for them to live in. The absence of these fires causes a build up of brush, which feeds uncontrollable summer bush fires. Livestock grazing, competition with introduced rabbits, predation by exotic feral cats and red foxes, and loss of habitat due to fragmentation and clearing has decimated rufous hare-wallaby populations on the mainland. Island populations are relatively stable, but susceptible to catastrophic events and population fluctuations.

Rufous hare-wallabies are classified as vulnerable by the IUCN, listed in Appendix 1 of CITES, and endangered in Endangered Species Protection Act. Conservation measures are being taken to maintain current wild populations and to breed the ones in captivity. The Mala Recovery Plan was designed to maintain the status of island populations and to improve the status of the mainland population to vulnerable within 10 years. It also hopes to maintain existing captive populations, create three self-sustaining wild populations on the mainland with predator control, or make them predator free, secure island populations with appropriate management techniques, raise public awareness and support for the plight of this species, clarify taxonomy, and develop effective management and translocation prescriptions.

US Federal List: endangered

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Lagorchestes hirsutus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU – D2) on the IUCN Red List 2002 (1) and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no recent population estimates for Dorre and Bernier Islands. There were estimated to collectively hold 4,300 - 6,700 animals prior to 1994 (Richards 2005). Populations on these islands fluctuate with environmental conditions (Johnson and Burbidge 2008).

The translocated population on Trimouille Island began as 30 individuals in 1998, and were last estimated to number more than 120 (although this estimate was made not from trap data, but from tracks and droppings) (Richards 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species declined on the mainland through habitat alteration due to rabbits, grazing and frequent and extensive wildfire. Predation by cats and foxes has acted to drive remnant populations to extinction. Island populations have a limited distribution and are threatened by the potential introduction of predators.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The tale behind the decline of the rufous hare wallaby is an interesting one as it dates back to the colonisation of Australia (2). The aborigine people of Australia used to set fire to the scrubland every year in order to clear areas for hunting in the winter months (4). This produced a patchwork of vegetation in different stages of regeneration which not only provided food for the rufous hare wallaby but also prevented the build-up of brush, a grass that fuels summer bush fires (4). After the aborigines were removed from these areas by the British, the wallabies' numbers began to drop. Without winter fires there were fewer regenerating plants and less food available long-term (2). Instead, uncontrolled summer fires raged, causing widespread damage and killing large numbers of animals, including rufous hare wallabies (4). This caused severely reduced populations which have never been able to recover. More recently, these animals have suffered from other threats including the clearing and fragmentation of habitat in southwestern Australia, predation by introduced cats and foxes as well as competition from introduced rabbits (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Rufous Hare-wallaby is listed both country-wide and in the Northern Territory.
Australia: Endangered (Environment Protection and Biodiversity Conservation Act 1999).
Northern Territory: Extinct in the Wild. (Territory Parks and Wildlife Conservation Act 2000).
This species is listed on Appendix I of CITES.

There have been a couple of Recovery Plans for this species (Lundie-Jenkins 1995; Langford 1999), as well as an update (Richards 2005). Specific objectives for the recovery of the species within the 2005-2010 period come directly from Richards (2005), and include:

1. Protect the wild Bernier and Dorre Island populations and their habitat;
2. Maintain captive breeding populations;
3. Maintain the introduced Trimouille Island population;
4. Reintroduce to mainland and island sites;
5. Conduct a population viability analysis of wild and reintroduced populations;
6. Research taxonomic status and genetic structure;
7. Enhance community participation and education; and
8. Secure ongoing funding for the implementation of the Recovery Plan.

The primary success of these will depend, in part, on preventing introduced predators from disrupting reintroduced populations and the prevention of large fires in areas where this species is present because they have the potential to destroy whole populations (Richards 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Now classified as vulnerable by the International Union for Conservation of Nature and Natural Resources (IUCN) Red List (1), and listed on Appendix I of the Convention for International Trade of Endangered species (CITES) (3), conservation measures are being taken to protect the remaining wild populations and to breed more in captivity. In Australia the Mala Recovery Plan has been developed to maintain existing captive populations and secure island populations (6). It also aims to establish 3 new self-sustaining populations on the mainland in predator-free or predator-controlled sites within 5 years, and increase public awareness of the rufous hare wallaby by involving community groups (6). It is hoped that these measures will be successful in stabilising and re-building the rufous hare wallaby numbers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Lagorchestes hirsutus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Lagorchestes hirsutus were once so abundant that they were an important food source for aboriginal people in Australia. Current populations are too low to sustain any type of harvest.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rufous hare-wallaby

The rufous hare-wallaby (Lagorchestes hirsutus), also known as the mala, is a small macropod found in Australia. It was formerly widely distributed across the western half of the continent but is now confined to Bernier Island and Dorre Island Islands off Western Australia.[3] It is currently classified as vulnerable.[2]

The rufous hare-wallaby has rufous-grey fur and is the smallest hare-wallaby. It is a solitary nocturnal hunter that feeds on herbs, leaves and seeds. It is currently being reintroduced to mainland Australia, notably in the Tanami Desert in the Northern Territory.[3]

The species was first described by John Gould (1844) in The Mammals of Australia.

Four distinct subpopulations of this species have been described as subspecies, especially with regard to their conservation status. Estimates of these island colonies numbers were between 4,300 and 6,700 in 1994, the environmental conditions cause fluctuations in the total number of animals.

Two possible subspecies are found in range restricted to islands near Western Australia.

The fourth is an unnamed subspecies that has been conserved by relocation.

  • Lagorchestes hirsutus ssp. was originally discovered in the Tanami Desert, and was once widespread across the arid centre of Australia. The only existing members of this group have been translocated to several sites in Western Australia as captive colonies. These are at the Dryandra Conservation Reserve, Shark Bay and Trimouille Island. The colony on the latter is estimated to be over 100 individuals.[2]

Significance in Anangu (aboriginal) culture

For the Anangu, or Aboriginal people, the Mala or 'hare wallaby people' are important ancestral beings. For tens of thousands of years, the Mala have watched over them from rocks and caves and walls, guiding them on their relationships with people, plants and animals, rules for living and caring for country. Mala Tjukurpa, the Mala Law, is central to their living culture and celebrated in story, song, dance and ceremony.[4]

References

  1. ^ Groves, C. (2005). Wilson, D. E., & Reeder, D. M, eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 63. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ a b c d Richards, J., Morris, K., Friend, T. & Burbidge, A. (2008). Lagorchestes hirsutus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is listed as vulnerable
  3. ^ a b Menkhorst, Peter (2001). A Field Guide to the Mammals of Australia. Oxford University Press. p. 108. 
  4. ^ Mala Reintroduction Factsheet. environment.gov.au
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!