Overview

Brief Summary

Biology

Philippine tarsiers are nocturnal animals that are also active at dusk and dawn (2). They spend the day sleeping in dense vegetation or occasionally in a hollow tree, and then as the sun sets, they begin their search for insect prey. Philippine tarsiers are agile acrobats of the forest, making vertical leaps from tree to tree with ease (2). Their head can rotate nearly 360°, and this, along with their enormous eyes, gives them an excellent field of vision (2). Once an insect is spotted, the Philippine tarsier will carefully adjust its position and focus, and then leap forward to seize the prey in both hands (2), their slender fingers creating a cage in which to hold flittering insects (4). During the hours the Philippine tarsier is awake, its thin ears are almost constantly being furled or crinkled (2). Generally seen in pairs of a male and female, the Philippine tarsier gives birth to a single young. Incredibly, the well-developed young weigh 25 percent of the mother's weight, a greater percentage than any other mammal (4). These large babies are well-furred, have their eyes open (2) (4), and are immediately capable of climbing and making short hops, although full leaps are not undertaken until one month of age. As the mother moves around the trees, the young will cling to her abdomen or be carried in her mouth. At 42 days of age, the young Philippine tarsier begins to capture its own insects, and shortly after this it is weaned. In captivity, a Philippine tarsier lived for just over 13 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The most notable feature of this extraordinary looking primate is its enormous eyes (2); tarsiers have the biggest eyes relative to their body weight of any mammal (4). As well as huge eyes, the Philippine tarsier has large, membranous ears set on its rounded head. It has short forelimbs, but greatly elongated hindlimbs, a feature which is reflected in this species name as tarsier refers to the elongated tarsal or ankle region (2). Its long digits culminate in rounded pads that provide the tarsier with effective grip on any surface. The fully opposable first toes also help the tarsier grip to slender branches (2). All the fingers and toes have flattened nails, except for the second and third toes which have claw-like nails used in grooming (2). The Philippine tarsier has wavy fur with a silky texture, ranging in colour on the upperparts from buff or greyish-brown to dark brown. The fur on the underparts is buff, greyish or slate (2). The tail is naked apart from a few short hairs on the tip, and is used as an extra support when clinging to an upright branch (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the southeastern Philippines. It is restricted to the greater Mindanao faunal region, where it is found on Bohol, Dinagat, Leyte, Mindanao (Davao del Norte, Davao del Sur, Misamis Occidental, Misamis Oriental, South Cotabato, and Zamboanga del Norte, Zamboanga del Sur provinces), and Samar (Heaney et al. 1998). It is also reported from Basilan (Lawrence 1939), Biliran, Maripipi (Rickart et al. 1993), and Mindanao in Bukidnon province (Sanborn 1953).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tarsius syrichta is found in the rainforests of the Philippines. This species is most commonly found on Samar, Leyte, Bohol, and Mindanao.

Biogeographic Regions: oriental (Native )

Other Geographic Terms: island endemic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Philippines

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to the Philippines, where it occurs on the islands of Samar, Leyte, Dinagat, Siargao, Bohol, Mindanao, Maripipi and Basilan (1) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tarsius syrichta is a small brownish-grayish mammal. Their colors vary depending upon the region of the Philippines that they inhabit. Some have reddish-brown hair.

Body size is approximately 85 to 160 mm, with weights between 80 and 165 g. They are about the size of a young child's hand. They have a 25 cm long tail that is tufted at the end.

Tarsiers have large ears, resembling a bat, and round faces. The area surrounding their eyes is usually darker than their body, with no white marks anywhere on the face. The eyes are huge, and their vision is acute. In proportion to their body, their eyes are the largest among mammals. The tarsier's great hearing, coupled with their amazing sense of sight, make them highly successful nocturnal hunters. Their heads can rotate 180 degrees.

The legs and arms of these tarsiers are long and slender. Some of their digits have flattened nails and some have claws which are used for grooming. They have pads on their fingers and toes to help them cling to branches. Their legs are strong, and they are capable of jumping distances up to twenty feet.

Tarsiers differ from other prosimians in several characters. These include two grooming claws on each foot, lack of a toothcomb formed by the lower canines and incisors, and a diploid number of eighty chromosomes. Tarsiers are also less vocal than many other primates.

Range mass: 85 to 165 g.

Range length: 80 to 160 mm.

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.43 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species occurs in both secondary and primary forest (although it is most abundant in the latter), from sea level up to 750 m. It is found at lower densities in edge habitats and secondary growth with many pole-sized trees and low-stature vegetation, as well as in gardens and other degraded habitats including agricultural areas and plantations. It feeds on small lizards, frogs, and insects.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Philippine tarsiers are found in areas of tall grasses, bushes, bamboo shoots, and small trees in tropical rainforests. They enjoy the canopy of the jungle, leaping from limb to limb. Tarsiers usually do not move using four limbs; rather, they have developed excellent leaping skills.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Philippine tarsier preferentially inhabits secondary forest, scrub, and clearings with thick vegetation, although it also been found in primary forest and mangroves (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Philippine tarsiers are primatily insectivorous. They eat insects, spiders, lizards, and small vertebrate animals such as birds. Upon seizing its prey, a tarsier carries it in its mouth and using both hands.

Animal Foods: birds; reptiles; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As predators, these small primates may help to structure insect communities. To the extent that they are preyed upon by other animals, they may impact predator populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predation upon these animals has not been widely reported. However, because of their nocturnal and arboreal habits, they are most likely to fall prey to owls, or to small carnivores which can encounter them in their canopy homes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Tarsiers use varied means of communication. Although less vocal than many primate species, these animals use calls which are often associated with territorial maintenance and male-female spacing. In addition, they use scent marks from urine and glandular secretions to delineate their territories. Tactile communication plays some role between mates and between mothers and their offspring. The role of visual communication has not been established for this species, but because they have very keen eyesight, it is likely that body postures and other visual signals are used.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

One T. syrichta is reported to have lived 13.5 years in captivity. It is likely that wild animals do not live as long as their captive counterparts.

Range lifespan

Status: captivity:
13.5 (high) years.

Average lifespan

Sex: male

Status: captivity:
15.0 years.

Average lifespan

Status: captivity:
13.0 years.

Average lifespan

Status: captivity:
13.0 years.

Average lifespan

Status: captivity:
13.4 years.

Average lifespan

Sex: male

Status: captivity:
13.5 years.

Average lifespan

Status: captivity:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16 years (captivity) Observations: One male reportedly lived over 10 years in captivity, making it about 16 years old (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

These animals are usually seen in male-female pairs, indicating that like other tarsiers, they probably mate monogamously.

Mating System: monogamous

Breeding occurs throughout the year. Tarsier females bear a single young. The gestation period lasts six months. Recent research shows that the breeding season of tarsiers is defined by the availability of insects.

Young are able to capture prey by about 45 days of age, and are thought to be weaned around that time.

Breeding interval: Most tarsiers breed twice per year.

Breeding season: Breeding occurs throughout the year.

Average number of offspring: 1.

Average gestation period: 6 months.

Average weaning age: 45 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 25.9 g.

Average gestation period: 179 days.

Average number of offspring: 1.

The females have multiple pairs of nipples; however, only the pectoral are used. Offspring are born well-furred and with eyes open. They are able to move about after only two days. Infants are carried by means of their mother's mouth or on her belly. No nest is built. The young tarsiers can climb after two days and jump after four. Normal locomotor patterns ensue at approximately nineteen days. Juveniles tend to be more uniformly colored than adults.

Females provide the bulk of parental care. The role of the male in rearing the young has not been documented.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tarsius syrichta

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2531-09|NC_012774|Tarsius syrichta| AACCGTTGATTATTCTCAACTAACCATAAAGACATCGGAACTCTATACTTATTATTTGGTGCTTGAGCCGGAATAGTAGGGACTGCCCTT---AGCCTTCTTATTCGAGCAGAGCTCGGACAGCCAGGAGCTCTACTAGGAGAT---GATCAAATCTATAATGTCGTCGTCACTGCTCATGCTTTCGTAATAATTTTCTTTATAGTTATACCTATTATAATCGGAGGCTTCGGCAACTGACTAGTGCCTCTTATA---ATCGGAGCCCCCGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGGCTTCTGCCACCTTCTTTCCTTTTATTATTAGCCTCCTCAATAGTAGAAGCAGGCGCAGGAACTGGTTGAACCGTATATCCCCCTCTAGCAGGAAACTTGGCCCACGCAGGAGCTTCTGTAGATCTT---ACTATTTTCTCTCTTCACTTAGCAGGTGTGTCCTCTATTTTAGGCGCTATTAATTTTATTACTACCATTATCAATATAAAACCTCCCGCTATATCACAATACCAAACCCCTCTATTTGTGTGATCTGTCCTCATTACCGCAGTCCTGCTGTTATTATCTCTCCCAGTCCTAGCAGCA---GGAATTACCATACTTCTAACTGATCGAAATCTCAACACAACCTTCTTTGACCCCGCTGGCGGAGGAGACCCTATTCTCTACCAACACTTATTTTGATTCTTCGGTCATCCTGAAGTCTATGTCCTTATCCTACCTGGATTTGGCATAATTTCCCATATCGTAACCTACTATTCTGGGAAGAAA---GAACCATTTGGCTACATAGGAATAGTTTGAGCAATAATATCCATCGGATTTCTAGGCTTTATTGTCTGAGCCCATCATATGTTCACAGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tarsius syrichta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Shekelle, M. & Arboleda, I.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Near Threatened, based on an estimated significant decline over the last three generations (approximately 20 years), but less than 30%, based habitat loss (the species occurs at higher densities in less disturbed forest habitats) and because of harvesting for the pet trade. Almost qualifies as threatened under criterion A2d.

History
  • 2000
    Data Deficient
  • 1996
    Lower Risk/conservation dependent
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The current condition of T. syrichta is threatened and endangered. Captive breeding efforts have been started but to date all have been unsuccessful. Tarsiers have suffered greatly from hunters and trappers who shake the animals out of their trees or chop down the branches of the trees in which they live. They have also become popular in the pet industry, especially in Mexico. However, tarsiers rarely live long in captivity. It has been reported that they are so traumatized by captivity that they beat their heads against their cages, eventually killing themselves. Philippine tarsiers are also significantly affected by the increased rate of deforestation in their native habitat.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 10/19/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: T

For most current information and documents related to the conservation status and management of Tarsius syrichta , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List 2007 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is locally common and widespread, largely because of its tolerance of second growth habitat (Dagosto and Gebo 1995). However, it clearly occurs at higher densities in less disturbed habitats (I. Arboleda pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are several contributing factors that make this species susceptible to extinction (Wright et al. 2003): infant mortality rates, both in the wild and in captivity, are very high; highly specialized diet; relatively limited geographical range; high population density and extensive habitat destruction. Although it is clearly adaptable to anthropogenic habitats that contain bushes or trees, it occurs at higher densities in less disturbed habitats, especially in primary forest (very little of which remains within its range) (I. Arboleda pers. comm.). It is also heavily harvested as food and especially for the pet trade. This is illegal, but there are recent anecdotal reports that the pet markets in Manila are being flooded with tarsiers retailing at less than PhP500 per individual (I. Arboleda pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Numbers of Philippine tarsiers are falling as their forest habitat is destroyed (5). However, the IUCN deemed that there is insufficient information to determine the extent to which the Philippine tarsier may be threatened, and so it is currently assessed as Data Deficient (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is included in Appendix II of CITES and is protected under government law in the Philippines. Surveys of population status, particularly to determine its ability to persist in non-forest areas in the long-term, as well as taxonomic research, are needed. The species would also benefit from tighter controls on harvest and trade.

This species occurs in a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There are currently no parks or reserves within the range of the Philippine tarsier. Protected areas are very likely to mitigate the threat of habitat loss to the tarsier, and thus surveys to determine where protected areas would be most beneficial are needed (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There is no known negative impact of these animals on humans, so long as the tarsiers are in their native environment. However, when kept as pets, there is a possibility that they may spread worms and other parasites to their human owners.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tarsiers are sometimes kept as pets, although their survival in captivity is erratic due to their need for live insects upon which to feed. Scientists are interested in these animals because of their unique taxonomic position, and study of tarsiers may aid human economies.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!