Overview

Brief Summary

Biology

Very few observational studies were carried out on wild or captive thylacines; we therefore know very little about their natural ecology and behaviour (3). These carnivores are reported to have been mainly solitary and nocturnal (4), although small groups probably consisting of a mother and her offspring have been reported (3). Due to conflicting reports, there is some controversy as to whether breeding occurred more often in the summer or winter. Litters of up to four young were possible due to the four teats within the female's backwards-opening pouch (3). Young remained in the pouch for around four months (7) and then were probably left in a den whilst the mother went on hunting forays; the young may have joined her on these trips when they were older (2). Thylacines were carnivorous and are likely to have preyed upon kangaroos, small rodents and birds (4). Some reports suggest that these mammals hunted by pursuing their prey over great distances until it tired (3). Thylacines became notorious for killing sheep once European settlers began to farm, a factor that was at the forefront of their persecution. The thylacine is reported to have a fairly stiff gait, but is also believed to have been an agile animal and had been seen standing on its hind legs, supported by its tail in a manner resembling a kangaroo (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The thylacine was the largest marsupial carnivore but it is now widely believed to be extinct (1). Despite similarities with canids such as the wolf, the thylacine was extremely distinctive, and the canine appearance was offset by the tapered hindquaters, relatively short legs and broad-based tail (2), which cannot be wagged from side-to-side (7). The short, coarse fur was a dirty yellow-brown with 13 to 19 transverse brown stripes running from the upper back to the base of the tail (3); animals from highland areas had a richer cinnamon-brown coat (7). There were lighter patches of fur (3) surrounding the eyes and near the erect, rounded ears (4). The belly was cream coloured, females carried a backwards-opening pouch (3), and males possessed a pseudo pouch in the form of a fold of skin that protected the testes when moving quickly through low bushland (7). The thylacine was renowned for its ability to open its jaw remarkably wide; whilst it is highly unlikely that this yawn was as wide as is sometimes quoted (180°), the gape was still the widest of any mammal (3), and is surpassed only by that of the snake (7). This species is a classic example of 'convergent evolution'; it is a marsupial mammal that closely resembles the placental canids, especially the wolf from which one of its common names is derived, due to the similarities in their way of life (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Thylacinus cynocephalus was endemic to Australia. Mainland populations are thought to have disappeared following the introduction of domestic dogs by Aboriginal human populations several thousand years ago (though there is the possibility that it survived until much more recently on the mainland) (Mooney and Rounsevell 2008). This restricted the Thylacine to the island of Tasmania. The last definite record of a wild individual is from 1933; it was captured and taken to Hobart Zoo where it died in 1936 (Mooney and Rounsevell 2008). Since then several surveys have been undertaken, however, no conclusive evidence of the existence of wild Thylacines has been found, despite numerous unconfirmed sightings.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Tasmanian Wolf was found only on the southwestern side of the island of Tasmania in recent history. The fossil record shows that it was found in New Guinea and Australia as recently as 3,000 years ago. This single member of this genus is thought to be extinct.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Australia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The thylacine once ranged throughout Tasmania, mainland Australia and Papua New Guinea, although it may have been lost from the latter two locations more than 2,000 years ago (2). It was still widespread in Tasmania at the time of European colonisation but by the early 20th Century had been massively reduced, and in 1930 the last recorded killing of a wild individual occurred (1). The last captive thylacine (known as Benjamin) persisted in Hobart Zoo until 1936, and despite a number of unsubstantiated sightings, the species is now believed to be extinct (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Overall appearance is very canid-like. Total body length is around 1000-2000mm. The tail length is around 500-650mm. The tail itself is very thick close to the body and quickly tapers to a point. It is around 600mm in height at the shoulder. The upper body is brownish/gray with a pale underside. There are 13-19 black vertical stripes that run from the midback to the base of the tail. The face is gray with white markings around the eyes. The fur is short and thick. Dental formula= i 4/3, c 1/1, pm 3/3, m 4/4. Tasmanian wolves have long canines, shearing premolars, and grinding molars, all of which are quite similar to those of dogs. The feet are padded and leave a five-toed print. The females pouch is located by her tail and has a fold of skin covering the four mammae.

Range mass: 20 to 25 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The preferred habitat of the species probably was open forest or grassland, however, the last populations may have occupied the less accessible, dense rainforest areas of south-western Tasmania.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Tasmanian Wolf preferred open forests and grasslands, but by the end of its existence it was confined to dense rainforests by human pressures. Tasmanian wolf lairs were located mainly in hollow logs or rock outcroppings located in hilly areas that were adjacent to open areas, such as grasslands.

Terrestrial Biomes: savanna or grassland ; forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Thylacines preferred open forest and grassland (1). As the human population expanded however, thylacines retreated into the more inaccessible hinterland of Tasmania (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The food habits of the Tasmanian Wolf are not well known. Its diet is thought to have consisted of wallabies, small birds, kangaroos, and other small mammals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
13.0 years.

Average lifespan

Status: captivity:
8.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The breeding season is thought to have taken place in the fall. Births occured continously throughout the year but were concentrated in the summer months (December-March). It is believed that the young (usually 2-4) stayed in the pouch for about 3 months and remained with the mother for another 6 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thylacinus cynocephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1891-09|FJ515781|Thylacinus cynocephalus| AACCGCTGACTATTCTCTACTAACCATAAAGACATCGGTACTTTATACCTTCTATTTGGCGCTTGAGCGGGTATAATCGGAACAGCACTT---AGCCTGTTAATCCGGGCAGAATTAGGTCAACCAGGTACCCTAATTGGAGAC---GATCAAATCTATAACGTTATCGTTACAGCCCACGCATTCGTAATAATCTTTTTTATAGTAATACCCATTATAATTGGAGGGTTTGGTAACTGATTAGTTCCACTAATA---ATCGGAGCTCCAGATATAGCCTTCCCACGAATAAACAACATAAGCTTTTGACTTCTTCCACCCTCTTTCCTTTTACTCCTAGCATCCTCTACAATTGAAGCTGGAGCTGGAACTGGATGGACTGTATACCCTCCCTTAGCAGGAAATCTAGCCCATGCAGGAGCCTCAGTAGATTTA---GCAATCTTCTCTCTTCACCTAGCCGGTATCTCATCTATTCTAGGGGCTATTAATTTCATCACAACAATTATCAATATAAAACCTCCAGCCCTATCCCAATATCAAACTCCATTATTTGTTTGATCAGTGATAATTACAGCAGTACTTCTACTCTTATCCTTACCCGTTCTGGCAGCA---GGCATTACAATACTACTTACGGACCGAAATCTTAATACAACATTTTTTGACCCTGCTGGAGGAGGTGACCCAATCCTTTATCAACATCTATTTTGATTTTTTGGTCACCCGGAAGTATACATCCTTATTTTACCAGGATTCGGCATTATCTCCCATATCGTTACCTATTATGCCGGAAAAAAA---GAACCATTTGGCTACATAGGCATAGTATGAGCAATAATATCAATTGGCTTCCTTGGATTCATTGTCTGAGCACATCACATATTCACTGTAGGCCTTG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thylacinus cynocephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EX
Extinct

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
McKnight, M.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Extinct. The last confirmed record of a wild individual is from 1933; it was captured and taken to Hobart Zoo where it died in 1936. Numerous sightings since that time have not been confirmed and several organized searches for the animal have failed to find conclusive evidence of the species' existence.

History
  • 1996
    Extinct
  • 1994
    Extinct
    (Groombridge 1994)
  • 1990
    Extinct
    (IUCN 1990)
  • 1988
    Extinct
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Extinct
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Extinct
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The Tasmanian Wolf is thought to be extinct. The last know living specimen died in a Hobart, Tasmania zoo in 1936. Since then there have been many unsuccessful searches of the remaining area where the Tasmanian Wolf could have survived undetected by humans. A 647,000 ha. reserve was set up in 1966 in Southwestern Tasmania in the hopes that possible surviving wolves would have adequate habitat. There have been many hundreds of uncomfirmed sightings of Tasmanian wolves, also known as Tasmanian tigers, in Tasmania as well as on mainland Australia and New Guinea. However, no credible photographs, hair samples, or tracks have ever been recovered and most sightings turn out to be mis-identifications.

The main factors leading to the demise of this species were overhunting, habitat destruction, disease, and competition with domesticated dogs.

(Tasmanian Department of Primary Industries, Water, and Environment, 2002)

IUCN Red List of Threatened Species: extinct

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Thylacinus cynocephalus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Extinct (EX) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is presumed to be extinct.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The Thylacine was regarded as a threat to sheep and was hunted, trapped, and poisoned both for private and government bounties. In addition to these hunting pressures, habitat modification, increased competition from domestic dogs and disease may have all contributed to the demise of this species (Mooney and Rounsevell 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

There is still no conclusive evidence as to what caused the disappearance of the thylacine from mainland Australia, although competition with introduced Asian dogs (dingos) is widely believed to have played a part (3). On the island of Tasmania (where there are no dingos) the thylacine was persecuted to extinction by a long-running eradication campaign (3). The species was widely blamed for many sheep attacks and by the mid 1800s was extensively hunted (3). Between 1888 and 1909, the Tasmanian Government paid bounty for 2,184 thylacine skins (6), although it is likely that the actual number killed during this time was many more. By the early 1900s, thylacines were noticeably rare and the last reported killing occurred in 1930 (1). Other factors such as habitat loss, disease and competition with feral dogs all helped to send this remarkable animal to extinction (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In 1936, the Thylacine received legal protection under Tasmanian law, although it was likely already extinct (Mooney and Rounsevell 2008). In 1966, a 647,000 ha game reserve was set up in south-western Tasmania, partly to protect any animals possibly remaining in the area. Currently there are no conservation measures pertaining to this species.
It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 1938, the thylacine became protected by Tasmanian law and in 1966 a game reserve was proposed (but not enforced) on Maria Island off the east coast of Tasmania, which would have protected any thylacines should they have been captured (7). Unconfirmed sightings of this fascinating marsupial continue to this day, but numerous searches have provided no concrete evidence that the species still exists (5). The UK's International Thylacine Specimen Database (ITSD), which was released on CD-ROM in April 2005, is a project that has endeavoured to catalogue and digitally photograph (where possible) all known surviving specimen material held within museum, university and private collections around the world. It comprises skins, skeletons, skulls, taxidermy mounts and wet specimens. Wet specimens include four adults preserved in alcohol and ten thylacine pups. The ITSD has been designed as a free access academic tool to promote and facilitate undergraduate and postgraduate research into the species, and helps to forever preserve what little is left (8). Such resources not only facilitate research into this extinct animal, but also serve as an important reminder of the fate that awaits many of our endangered species in the future, should we not do more to protect them now. The thylacine is still an important part of the Tasmanian national conscience and recent talks of the possibility of cloning an animal from DNA preserved in a specimen held at the Australian Museum has sparked massive debate (5). The practicalities of cloning however, and the ethical decisions involved, mean that this possibility is a very long way from becoming a reality (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The Tasmanian Wolf was thought to be a livestock killer. This was never substantiated, but because of this misconception the wolf was hunted (by the private sector and the government) from 1840-1909 for bounty.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

No documented examples.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thylacine

The thylacine (play /ˈθləsn/ THY-lə-syn,[3] or /ˈθləsn/ THY-lə-seen,[4] also /ˈθləsɨn/;[5] binomial name: Thylacinus cynocephalus, Greek for "dog-headed pouched one") was the largest known carnivorous marsupial of modern times. It is commonly known as the Tasmanian tiger (because of its striped back) or the Tasmanian wolf.[6] Native to continental Australia, Tasmania and New Guinea, it is thought to have become extinct in the 20th century. It was the last extant member of its family, Thylacinidae, although several related species have been found in the fossil record dating back to the early Miocene.

The thylacine had become extremely rare or extinct on the Australian mainland before European settlement of the continent, but it survived on the island of Tasmania along with several other endemic species, including the Tasmanian devil. Intensive hunting encouraged by bounties is generally blamed for its extinction, but other contributing factors may have been disease, the introduction of dogs, and human encroachment into its habitat. Despite its official classification as extinct, sightings are still reported, though none proven.

Like the tigers and wolves of the Northern Hemisphere, from which it obtained two of its common names, the thylacine was an apex predator. As a marsupial, it was not closely related to these placental mammals, but because of convergent evolution it displayed the same general form and adaptations. Its closest living relative is thought to be either the Tasmanian devil or numbat. The thylacine was one of only two marsupials to have a pouch in both sexes (the other being the water opossum). The male thylacine had a pouch that acted as a protective sheath, covering the male's external reproductive organs while he ran through thick brush. It has been described as a formidable predator because of its ability to survive and hunt prey in extremely sparsely populated areas.[7]

Contents

Evolution

The skulls of the thylacine (left) and the Timber Wolf, Canis lupus, are quite similar, although the species are only distantly related. Studies show the skull shape of the Red Fox, Vulpes vulpes, is even closer to that of the thylacine.[8]

The modern thylacine first appeared about 4 million years ago. Species of the family Thylacinidae date back to the beginning of the Miocene; since the early 1990s, at least seven fossil species have been uncovered at Riversleigh, part of Lawn Hill National Park in northwest Queensland.[9][10] Dickson's Thylacine (Nimbacinus dicksoni) is the oldest of the seven discovered fossil species, dating back to 23 million years ago. This thylacinid was much smaller than its more recent relatives.[11] The largest species, the powerful thylacine (Thylacinus potens) which grew to the size of a wolf, was the only species to survive into the late Miocene.[12] In late Pleistocene and early Holocene times, the modern thylacine was widespread (although never numerous) throughout Australia and New Guinea.[13]

An example of convergent evolution, the thylacine showed many similarities to the members of the dog family, Canidae, of the Northern Hemisphere: sharp teeth, powerful jaws, raised heels and the same general body form. Since the thylacine filled the same ecological niche in Australia as the dog family did elsewhere it developed many of the same features. Despite this, it is unrelated to any of the Northern Hemisphere predators.[14]

They are easy to tell from a true dog because of the stripes on the back but the skeleton is harder to distinguish. Zoology students at Oxford had to identify 100 zoological specimens as part of the final exam. Word soon got around that, if ever a 'dog' skull was given, it was safe to identify it as Thylacinus on the grounds that anything as obvious as a dog skull had to be a catch. Then one year the examiners, to their credit, double bluffed and put in a real dog skull. The easiest way to tell the difference is by the two prominent holes in the palate bone, which are characteristic of marsupials generally.

Richard Dawkins, The Ancestor's Tale

Discovery and taxonomy

Thylacine rock art at Ubirr

The indigenous peoples of Australia made first contact with the thylacine. Numerous examples of thylacine engravings and rock art have been found dating back to at least 1000 BC.[15] Petroglyph images of the thylacine can be found at the Dampier Rock Art Precinct on the Burrup Peninsula in Western Australia. By the time the first explorers arrived, the animal was already extinct in mainland Australia and rare in Tasmania. Europeans may have encountered it as far back as 1642 when Abel Tasman first arrived in Tasmania. His shore party reported seeing the footprints of "wild beasts having claws like a Tyger".[16] Marc-Joseph Marion du Fresne, arriving with the Mascarin in 1772, reported seeing a "tiger cat".[17] Positive identification of the thylacine as the animal encountered cannot be made from this report since the Tiger Quoll (Dasyurus maculatus) is similarly described. The first definitive encounter was by French explorers on 13 May 1792, as noted by the naturalist Jacques Labillardière, in his journal from the expedition led by D'Entrecasteaux. However, it was not until 1805 that William Paterson, the Lieutenant Governor of Tasmania, sent a detailed description for publication in the Sydney Gazette.[18]

Tasmanian devil and thylacine, both labeled as members of Didelphis, from Harris' 1808 description

The first detailed scientific description was made by Tasmania's Deputy Surveyor-General, George Harris in 1808, five years after first settlement of the island.[19][20] Harris originally placed the thylacine in the genus Didelphis, which had been created by Linnaeus for the American opossums, describing it as Didelphis cynocephala, the "dog-headed opossum". Recognition that the Australian marsupials were fundamentally different from the known mammal genera led to the establishment of the modern classification scheme, and in 1796 Geoffroy Saint-Hilaire created the genus Dasyurus where he placed the thylacine in 1810. To resolve the mixture of Greek and Latin nomenclature the species name was altered to cynocephalus. In 1824, it was separated out into its own genus, Thylacinus, by Temminck.[21] The common name derives directly from the genus name, originally from the Greek θύλακος (thýlakos), meaning "pouch" or "sack".[22][a]

Several studies support the thylacine as being a basal member of the Dasyuromorphia and that the Tasmanian devil is its closest living relative. However, research published in Genome Research in January 2009 suggests that the numbat may be more basal than the devil and more closely related to the thylacine.[23]

Description

Descriptions of the thylacine vary, as evidence is restricted to preserved joey specimens, fossil records, skins and skeletal remains, black and white photographs and film of the animal in captivity, and accounts from the field.

Specimen in the Oslo museum, showing colouration

The thylacine resembled a large, short-haired dog with a stiff tail which smoothly extended from the body in a way similar to that of a kangaroo. Many European settlers drew direct comparisons with the hyena, because of its unusual stance and general demeanour.[14] Its yellow-brown coat featured 13 to 21 distinctive dark stripes across its back, rump and the base of its tail, which earned the animal the nickname, "Tiger". The stripes were more marked in younger specimens, fading as the animal got older.[24] One of the stripes extended down the outside of the rear thigh. Its body hair was dense and soft, up to 15 mm (0.6 in) in length; in juveniles the tip of the tail had a crest. Its rounded, erect ears were about 8 cm (3.1 in) long and covered with short fur.[25] Colouration varied from light fawn to a dark brown; the belly was cream-coloured.[26]

The mature thylacine ranged from 100 to 130 cm (39 to 51 in) long, plus a tail of around 50 to 65 cm (20 to 26 in).[27] The largest measured specimen was 290 cm (9.5 ft) from nose to tail.[26] Adults stood about 60 cm (24 in) at the shoulder and weighed 20 to 30 kg (40 to 70 lb).[27] There was slight sexual dimorphism with the males being larger than females on average.[28]

Thylacine footage compilation.ogv
All known Australian footage of live thylacines, shot in Hobart Zoo, Tasmania, in 1911, 1928, and 1933. Two other films are known, shot in London Zoo

The female thylacine had a pouch with four teats, but unlike many other marsupials, the pouch opened to the rear of its body. Males had a scrotal pouch, unique amongst the Australian marsupials,[29] into which they could withdraw their scrotal sac.[24]

The thylacine was able to open its jaws to an unusual extent: up to 120 degrees.[30] This capability can be seen in part in David Fleay's short black-and-white film sequence of a captive thylacine from 1933. The jaws were muscular but weak and had 46 teeth.[25][31]

The thylacine's footprint is easy to distinguish from those of native and introduced species.

Thylacine footprints could be distinguished from other native or introduced animals; unlike foxes, cats, dogs, wombats or Tasmanian devils, thylacines had a very large rear pad and four obvious front pads, arranged in almost a straight line.[32] The hindfeet were similar to the forefeet but had four digits rather than five. Their claws were non-retractable.[24]

The early scientific studies suggested it possessed an acute sense of smell which enabled it to track prey,[32] but analysis of its brain structure revealed that its olfactory bulbs were not well developed. It is likely to have relied on sight and sound when hunting instead.[24] Some observers described it having a strong and distinctive smell, others described a faint, clean, animal odour, and some no odour at all. It is possible that the thylacine, like its relative, the Tasmanian devil, gave off an odour when agitated.[33]

The thylacine was noted as having a stiff and somewhat awkward gait, making it unable to run at high speed. It could also perform a bipedal hop, in a fashion similar to a kangaroo—demonstrated at various times by captive specimens.[24] Guiler speculates that this was used as an accelerated form of motion when the animal became alarmed. The animal was also able to balance on its hind legs and stand upright for brief periods.[34]

Observers of the animal in the wild and in captivity noted that it would growl and hiss when agitated, often accompanied by a threat-yawn. During hunting it would emit a series of rapidly repeated guttural cough-like barks (described as "yip-yap", "cay-yip" or "hop-hop-hop"), probably for communication between the family pack members. It also had a long whining cry, probably for identification at distance, and a low snuffling noise used for communication between family members.[35]

Ecology and behaviour

One of only two known photos of a thylacine with a distended pouch, bearing young. Adelaide Zoo, 1889

Little is known about the behaviour or habitat of the thylacine. A few observations were made of the animal in captivity, but only limited, anecdotal evidence exists of the animal's behaviour in the wild. Most observations were made during the day whereas the thylacine was naturally nocturnal. Those observations, made in the twentieth century, may have been atypical as they were of a species already under the stresses that would soon lead to its extinction. Some behavioural characteristics have been extrapolated from the behaviour of its close relative, the Tasmanian devil.

Thylacine family at Beaumaris Zoo in Hobart, 1909
Thylacine family at Beaumaris Zoo in Hobart, 1910

The thylacine probably preferred the dry eucalyptus forests, wetlands, and grasslands in continental Australia.[32] Indigenous Australian rock paintings indicate that the thylacine lived throughout mainland Australia and New Guinea. Proof of the animal's existence in mainland Australia came from a desiccated carcass that was discovered in a cave in the Nullarbor Plain in Western Australia in 1990; carbon dating revealed it to be around 3,300 years old.[36]

In Tasmania it preferred the woodlands of the midlands and coastal heath, which eventually became the primary focus of British settlers seeking grazing land for their livestock.[37] The striped pattern may have provided camouflage in woodland conditions,[24] but it may have also served for identification purposes.[38] The animal had a typical home range of between 40 and 80 km2 (15 and 31 sq mi).[26] It appears to have kept to its home range without being territorial; groups too large to be a family unit were sometimes observed together.[39]

The thylacine was a nocturnal and crepuscular hunter, spending the daylight hours in small caves or hollow tree trunks in a nest of twigs, bark or fern fronds. It tended to retreat to the hills and forest for shelter during the day and hunted in the open heath at night. Early observers noted that the animal was typically shy and secretive, with awareness of the presence of humans and generally avoiding contact, though it occasionally showed inquisitive traits.[40] At the time, much stigma existed in regard to its "fierce" nature, however this is likely to be due to its perceived threat to agriculture.[41]

There is evidence for at least some year-round breeding (cull records show joeys discovered in the pouch at all times of the year), although the peak breeding season was in winter and spring.[24] They would produce up to four cubs per litter (typically two or three), carrying the young in a pouch for up to three months and protecting them until they were at least half adult size. Early pouch young were hairless and blind, but they had their eyes open and were fully furred by the time they left the pouch.[24] After leaving the pouch, and until they were developed enough to assist, the juveniles would remain in the lair while their mother hunted.[42] Thylacines only once bred successfully in captivity, in Melbourne Zoo in 1899.[43] Their life expectancy in the wild is estimated to have been 5 to 7 years, although captive specimens survived up to 9 years.[32]

Diet

Analysis of the skeleton suggests that, when hunting, the thylacine relied on stamina rather than speed in the chase.

The thylacine was exclusively carnivorous. Its stomach was muscular with an ability to distend to allow the animal to eat large amounts of food at one time, probably an adaptation to compensate for long periods when hunting was unsuccessful and food scarce.[24] Analysis of the skeletal frame and observations of it in captivity suggest that it preferred to single out a target animal and pursue that animal until it was exhausted. Some studies conclude that the animal may have hunted in small family groups, with the main group herding prey in the general direction of an individual waiting in ambush.[19] Trappers reported it as an ambush predator.[24]

Little is known of the thylacine's diet and feeding behaviour. Prey is believed to have included kangaroos, wallabies and wombats, birds and small animals such as potoroos and possums. One prey animal may have been the once common Tasmanian emu.[44] The emu was a large, flightless bird which shared the habitat of the thylacine and was hunted to extinction around 1850, possibly coinciding with the decline in thylacine numbers.[45] Both dingoes and foxes have been noted to hunt the emu on the mainland.[46][47] European settlers believed the thylacine to prey upon farmers' sheep and poultry.[48][49] Throughout the twentieth century, the thylacine was often characterised as primarily a blood drinker; according to Robert Paddle, the story's popularity seems to have originated from a single second-hand account heard by Geoffrey Smith in a shepherd's hut.[50] In captivity, thylacines were fed a wide variety of foods, including dead rabbits and wallabies as well as beef, mutton, horse, and occasionally poultry.[51] Thasmania's leading naturalist Michael Sharland published an article in 1957 stating that a captive thylacine refused to eat either dead wallaby flesh or to kill and eat a live wallaby offered to it, but "ultimately it was persuaded to eat by having the smell of blood from a freshly killed wallaby put before its nose."[52]

A 2011 study by the University of New South Wales using advanced computer modelling indicated that the thylacine had surprisingly feeble jaws. Animals usually take prey close to their own body size, but an adult thylacine of around 30 kilograms (66 lb) was found to be incapable of handling prey much larger than 5 kilograms (11 lb). Researchers believe thylacines only ate small animals such as bandicoots and possums, putting them into direct competition with the Tasmanian devil and the Tiger Quoll. Such specialisation probably made the thylacine susceptible to small disturbances to the ecosystem.[31][53]

Extinction

Bagged thylacine, 1869

Extinction from mainland Australia

The thylacine is likely to have become near-extinct in mainland Australia about 2,000 years ago, and possibly earlier in New Guinea.[54][55] The absolute extinction is attributed to competition from indigenous humans and invasive dingoes. However, doubts exist over the impact of the dingo since the two species would not have been in direct competition with one another as the dingo hunts primarily during the day, whereas it is thought that the thylacine hunted mostly at night. In addition, the thylacine had a more powerful build, which would have given it an advantage in one-on-one encounters.[56] Recent morphological examinations of dingo and thylacine skulls show that although the dingo had a weaker bite, its skull could resist greater stresses, allowing it to pull down larger prey than the thylacine could. The thylacine was also much less versatile in diet than the omnivorous dingo.[57] Their environments clearly overlapped: thylacine subfossil remains have been discovered in proximity to those of dingoes. The adoption of the dingo as a hunting companion by the indigenous peoples would have put the thylacine under increased pressure.[13]

Rock paintings from the Kakadu National Park clearly show that thylacines were hunted by early humans.[58]

Extinction in Tasmania

This 1921 photo by Henry Burrell of a thylacine with a chicken was widely distributed and may have helped secure the animal's reputation as a poultry thief.
In fact the image is cropped to hide the fenced run and housing, and analysis by one researcher has concluded that this thylacine is a mounted specimen, posed for the camera.[59]

Although the thylacine had been close to extinction on mainland Australia by the time of European settlement, and went extinct there some time in the nineteenth century, it survived into the 1930s on the island state of Tasmania. At the time of the first settlement, the heaviest distributions were in the northeast, northwest and north-midland regions of the state.[37] They were rarely sighted during this time but slowly began to be credited with numerous attacks on sheep. This led to the establishment of bounty schemes in an attempt to control their numbers. The Van Diemen's Land Company introduced bounties on the thylacine from as early as 1830, and between 1888 and 1909 the Tasmanian government paid £1 per head for dead adult thylacines and ten shillings for pups. In all they paid out 2,184 bounties, but it is thought that many more thylacines were killed than were claimed for.[32] Its extinction is popularly attributed to these relentless efforts by farmers and bounty hunters.[32] However, it is likely that multiple factors led to its decline and eventual extinction, including competition with wild dogs introduced by European settlers,[60] erosion of its habitat, the concurrent extinction of prey species, and a distemper-like disease that also affected many captive specimens at the time.[26][61] Whatever the reason, the animal had become extremely rare in the wild by the late 1920s. Despite the fact that the thylacine was believed by many to be responsible for attacks on the sheep, in 1928 the Tasmanian Advisory Committee for Native Fauna had recommended a reserve to protect any remaining thylacines, with potential sites of suitable habitat including the Arthur-Pieman area of western Tasmania.[62]

Wilf Batty with the last thylacine that was killed in the wild

The last known Thylacine to be killed in the wild was killed in 1930 by Wilf Batty, a farmer from Mawbanna, in the northeast of the state. The animal, believed to have been a male, had been seen around Batty's house for several weeks.[63]

"Benjamin" and searches

The last captive thylacine, later referred to as "Benjamin" (although its sex has never been confirmed) was captured in 1933 by Elias Churchill and sent to the Hobart Zoo where it lived for three years. Frank Darby, who claimed to have been a keeper at Hobart Zoo, suggested "Benjamin" as having been the animal's pet name in a newspaper article of May 1968. However, no documentation exists to suggest that it ever had a pet name, and Alison Reid (de facto curator at the zoo) and Michael Sharland (publicist for the zoo) denied that Frank Darby had ever worked at the zoo or that the name "Benjamin" was ever used for the animal. Darby also appears to be the source for the claim that the last thylacine was a male; photographic evidence suggests it was female.[64][65] This thylacine died on 7 September 1936. It is believed to have died as the result of neglect—locked out of its sheltered sleeping quarters, it was exposed to a rare occurrence of extreme Tasmanian weather: extreme heat during the day and freezing temperatures at night.[66] This thylacine features in the last known motion picture footage of a living specimen: 62 seconds of black-and-white footage showing it pacing backwards and forwards in its enclosure in a clip taken in 1933 by naturalist David Fleay.[67][68] National Threatened Species Day has been held annually since 1996 on 7 September in Australia, to commemorate the death of the last officially recorded thylacine.[69]

The last known thylacine photographed at Beaumaris Zoo in 1933. A scrotal sac is not visible in this or any other of the photos or film taken, leading to the supposition that "Benjamin" was a female, but the existence of a scrotal pouch in the thylacine makes it impossible to be certain.

Although there had been a conservation movement pressing for the thylacine's protection since 1901, driven in part by the increasing difficulty in obtaining specimens for overseas collections, political difficulties prevented any form of protection coming into force until 1936. Official protection of the species by the Tasmanian government was introduced on 10 July 1936, 59 days before the last known specimen died in captivity.[70]

The results of subsequent searches indicated a strong possibility of the survival of the species in Tasmania into the 1960s. Searches by Dr. Eric Guiler and David Fleay in the northwest of Tasmania found footprints and scats that may have belonged to the animal, heard vocalisations matching the description of those of the thylacine, and collected anecdotal evidence from people reported to have sighted the animal. Despite the searches, no conclusive evidence was found to point to its continued existence in the wild.[14] Between 1967 and 1973 zoologist Jeremy Griffith and dairy farmer James Malley conducted what is regarded as the most intensive search ever carried out, including exhaustive surveys along Tasmania's west coast; installation of automatic camera stations; prompt investigations of claimed sightings; and in 1972 the creation of the Thylacine Expeditionary Research Team with Dr Bob Brown, which concluded without finding any evidence of the thylacine's existence.[71]

The thylacine held the status of endangered species until the 1980s. International standards at the time stated that an animal could not be declared extinct until 50 years had passed without a confirmed record. Since no definitive proof of the thylacine's existence in the wild had been obtained for more than 50 years, it met that official criterion and was declared extinct by the International Union for Conservation of Nature in 1982[2] and by the Tasmanian government in 1986. The Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) is more cautious, listing it as "possibly extinct".[72]

Unconfirmed sightings

Map showing location of sightings between 1936 and 1980 in Tasmania. Black = 1 sighting, red = 5 sightings

The Australian Rare Fauna Research Association reports having 3,800 sightings on file from mainland Australia since the 1936 extinction date,[73] while the Mystery Animal Research Centre of Australia recorded 138 up to 1998, and the Department of Conservation and Land Management recorded 65 in Western Australia over the same period.[40] Independent thylacine researchers Buck and Joan Emburg of Tasmania report 360 Tasmanian and 269 mainland post-extinction 20th-century sightings, figures compiled from a number of sources.[74] On the mainland, sightings are most frequently reported in Southern Victoria.[75]

Map of sightings in the south west of Western Australia

Some sightings have generated a large amount of publicity. In 1973, Gary and Liz Doyle shot ten seconds of 8mm film showing an unidentified animal running across a South Australian road. However, attempts to positively identify the creature as a thylacine have been impossible due to the poor quality of the film.[76] In 1982 a researcher with the Tasmania Parks and Wildlife Service, Hans Naarding, observed what he believed to be a thylacine for three minutes during the night at a site near Arthur River in northwestern Tasmania. The sighting led to an extensive year-long government-funded search.[77] In January 1995, a Parks and Wildlife officer reported observing a thylacine in the Pyengana region of northeastern Tasmania in the early hours of the morning. Later searches revealed no trace of the animal.[78] In 1997, it was reported that locals and missionaries near Mount Carstensz in Western New Guinea had sighted thylacines.[79][80] The locals had apparently known about them for many years but had not made an official report.[81] In February 2005 Klaus Emmerichs, a German tourist, claimed to have taken digital photographs of a thylacine he saw near the Lake St Clair National Park, but the authenticity of the photographs has not been established.[82] The photos were not published until April 2006, fourteen months after the sighting. The photographs, which showed only the back of the animal, were said by those who studied them to be inconclusive as evidence of the thylacine's continued existence.[83]

Rewards

In 1983, Ted Turner offered a $100,000 reward for proof of the continued existence of the thylacine.[84] However, a letter sent in response to an inquiry by a thylacine-searcher, Murray McAllister, in 2000 indicated that the reward had been withdrawn.[85] In March 2005, Australian news magazine The Bulletin, as part of its 125th anniversary celebrations, offered a $1.25 million reward for the safe capture of a live thylacine. When the offer closed at the end of June 2005 no one had produced any evidence of the animal's existence. An offer of $1.75 million has subsequently been offered by a Tasmanian tour operator, Stewart Malcolm.[83] Trapping is illegal under the terms of the thylacine's protection, so any reward made for its capture is invalid, since a trapping licence would not be issued.[84]

Modern research and projects

Stuffed specimen at National Museum of Australia in Canberra, Australian Capital Territory.

Records of all specimens, many of which are in European collections, are now held in the International Thylacine Specimen Database.

The Australian Museum in Sydney began a cloning project in 1999.[86] The goal was to use genetic material from specimens taken and preserved in the early 20th century to clone new individuals and restore the species from extinction. Several microbiologists have dismissed the project as a public relations stunt and its chief proponent, Professor Mike Archer, received a 2002 nomination for the Australian Skeptics Bent Spoon Award for "the perpetrator of the most preposterous piece of paranormal or pseudo-scientific piffle."[87]

Thylacine skeleton, Muséum national d'histoire naturelle, Paris

In late 2002 the researchers had some success as they were able to extract replicable DNA from the specimens.[88] On 15 February 2005, the museum announced that it was stopping the project after tests showed the DNA retrieved from the specimens had been too badly degraded to be usable.[89][90] In May 2005, Professor Michael Archer, the University of New South Wales Dean of Science at the time, former director of the Australian Museum and evolutionary biologist, announced that the project was being restarted by a group of interested universities and a research institute.[83][91]

The International Thylacine Specimen Database was completed in April 2005 and is the culmination of a four-year research project to catalog and digitally photograph, if possible, all known[62][92] surviving thylacine specimen material held within museum, university and private collections. The master records are held by the Zoological Society of London.[2]

In 2008 researchers Andrew J. Pask and Marilyn B. Renfree from the University of Melbourne and Richard R. Behringer from the University of Texas reported that they managed to restore functionality of a gene Col2A1 enhancer obtained from 100 year-old ethanol-fixed thylacine tissues from museum collections. The genetic material was found working in transgenic mice. The research enhanced hopes of eventually restoring the population of thylacines.[93][94] That same year, another group of researchers successfully sequenced the complete thylacine mitochondrial genome from two museum specimens. Their success suggests that it may be feasible to sequence the complete thylacine nuclear genome from museum specimens. Their results were published in the journal Genome Research in 2009.[23]

Cultural references

John Gould's lithographic plate from "Mammals of Australia"

The best known illustrations of Thylacinus cynocephalus were those in Gould's The Mammals of Australia (1845–63), often copied since its publication and the most frequently reproduced,[95] and given further exposure by Cascade Brewery's appropriation for its label in 1987.[96] The government of Tasmania published a monochromatic reproduction of the same image in 1934,[97] the author Louisa Anne Meredith also copied it for Tasmanian Friends and Foes (1881).[95]

The Tasmanian coat of arms features thylacines as supporters.

The thylacine has been used extensively as a symbol of Tasmania. The animal is featured on the official Tasmanian coat of arms.[98] It is used in the official logos of Tourism Tasmania and the Launceston City Council.[98] It is also used on the University of Tasmania's ceremonial mace and the badge of the submarine HMAS Dechaineux.[98] Since 1998, it has been prominently displayed on Tasmanian vehicle number plates.

The plight of the thylacine was featured in a campaign for The Wilderness Society entitled We used to hunt thylacines. In video games, boomerang-wielding Ty the Tasmanian Tiger is the star of his own trilogy. Characters in the early 1990s cartoon Taz-Mania included the neurotic Wendell T. Wolf, the last surviving Tasmanian wolf. Tiger Tale is a children's book based on an Aboriginal myth about how the thylacine got its stripes. The thylacine character Rolf is featured in the extinction musical Rockford's Rock Opera. The thylacine is the mascot for the Tasmanian cricket team,[98] and has appeared in postage stamps from Australia, Equatorial Guinea, and Micronesia.[99]

The Hunter is a novel by Julia Leigh about an Australian hunter who sets out to find the last thylacine. The novel has been adapted into a 2011 film by the same name directed by Daniel Nettheim, and starring Willem Dafoe.[100]

See also

Notes

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 23. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=10800004. 
  2. ^ a b c "Thylacinus cynocephalus". http://www.iucnredlist.org/apps/redlist/details/21866/0. Retrieved 23 July 2010. 
  3. ^ "thylacine". Oxford English Dictionary. Oxford University Press. 3rd ed. 2001.
  4. ^ Macquarie ABC Dictionary. The Macquarie Library Pty Ltd. 2003. p. 1032. ISBN [[Special:BookSources/0-87642-937-2|0-87642-937-2]]. 
  5. ^ "thylacine", Dictionary.com Unabridged (v 1.1). Random House, Inc. 30 May 2009. <Dictionary.com http://dictionary.classic.reference.com/browse/thylacine>.
  6. ^ As well as the common alternative names,the thylacine was referred to by a range of other names, which often makes clear identification of the species in historical records difficult. Other names by which it is occasionally identified include marsupial wolf, hyena, zebra wolf, kangaroo wolf, zebra opossum, marsupial tiger, tiger cat, Tasmanian pouched wolf and hyena opossum.
  7. ^ The Last Tasmanian Tiger: The History and Extinction of the Thylacine (2002) Robert Paddle
  8. ^ L Werdelin (1986). "Comparison of Skull Shape in Marsupial and Placental Carnivores". Australian Journal of Zoology 34 (2): 109–117. doi:10.1071/ZO9860109. 
  9. ^ "Riversleigh". Australian Museum. 1999. http://www.amonline.net.au/fossil_sites/riversleigh.htm. Retrieved 21 November 2006. 
  10. ^ "Is there a fossil Thylacine?". Australian Museum. 1999. http://www.amonline.net.au/thylacine/08.htm. Retrieved 21 November 2006. 
  11. ^ "Lost Kingdoms: Dickson's Thylacine (Nimbacinus dicksoni)". Australian Museum. 1999. http://www.lostkingdoms.com/facts/factsheet22.htm. Retrieved 21 November 2006. 
  12. ^ "Lost Kingdoms: Powerful Thylacine (Thylacinus potens)". Australian Museum. 1999. http://www.lostkingdoms.com/facts/factsheet38.htm. Retrieved 21 November 2006. 
  13. ^ a b C.N. Johnson and S, Wroe (2003-11). "Causes of extinction of vertebrates during the Holocene of mainland Australia: arrival of the dingo, or human impact?". The Holocene 13 (6): 941–948. doi:10.1191/0959683603hl682fa. 
  14. ^ a b c "Threatened Species: Thylacine – Tasmanian tiger, Thylacinus cynocephalus" (PDF). Parks and Wildlife Service, Tasmania. 2003-12. Archived from the original on 2 October 2006. http://web.archive.org/web/20061002050127/http://www.parks.tas.gov.au/factsheets/threatened_species/Thylacine.pdf. Retrieved 22 November 2006. 
  15. ^ Anna Salleh (15 December 2004). "Rock art shows attempts to save thylacine". ABC Science Online. http://www.abc.net.au/science/news/ancient/AncientRepublish_1265476.htm. Retrieved 21 November 2006. 
  16. ^ Rembrants. D. (1682). "A short relation out of the journal of Captain Abel Jansen Tasman, upon the discovery of the South Terra incognita; not long since published in the Low Dutch". Philosophical Collections of the Royal Society of London, (6), 179–86. Quoted in Paddle (2000) p.3
  17. ^ Roth H.L. (1891). "Crozet's Voyage to Tasmania, New Zealand, etc....1771–1772.". London. Truslove and Shirley. Quoted in Paddle (2000) p.3
  18. ^ Robert Paddle (2000). The Last Tasmanian Tiger: The History and Extinction of the Thylacine. Cambridge University Press. p. 3. ISBN 0-521-53154-3. 
  19. ^ a b "Information sheet: Thylacine Thylacinus cynocephalus" (PDF). Victoria Museum. 2005-04. Archived from the original on 9 November 2006. http://web.archive.org/web/20061109214310/http://www.museum.vic.gov.au/infosheets/10283.pdf. Retrieved 21 November 2006. 
  20. ^ "Thylacinus cynocephalus (Harris, 1808)". Australian Faunal Directory. ABRS. 9 October 2008. http://www.environment.gov.au/biodiversity/abrs/online-resources/fauna/afd/taxa/Thylacinus_cynocephalus. 
  21. ^ Robert Paddle (2002). The Last Tasmanian Tiger: The History and Extinction of the Thylacine. Cambridge University Press. p. 5. ISBN 0-521-53154-3. 
  22. ^ T. F. Hoad (Ed.) (1986). The Concise Oxford Dictionary of English Etymology. Oxford: Oxford University Press. ISBN 0-19-863120-0. 
  23. ^ a b Miller W, Drautz DI, Janecka JE, et al. (February 2009). "The mitochondrial genome sequence of the Tasmanian tiger (Thylacinus cynocephalus)". Genome Res. 19 (2): 213–20. doi:10.1101/gr.082628.108. PMC 2652203. PMID 19139089. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2652203. 
  24. ^ a b c d e f g h i j Joan Dixon. "Fauna of Australia chap.20 vol.1b" (PDF). Australian Biological Resources Study (ABRS). http://www.deh.gov.au/biodiversity/abrs/publications/fauna-of-australia/pubs/volume1b/20-ind.pdf. Retrieved 22 November 2006. 
  25. ^ a b "Australia's Thylacine: What did the Thylacine look like?". Australian Museum. 1999. http://www.amonline.net.au/thylacine/02.htm. Retrieved 21 November 2006. 
  26. ^ a b c d Dr Eric Guiler (2006). "Profile – Thylacine". Zoology Department, University of Tasmania. http://www.zoo.utas.edu.au/tfprofiles/tasanimals/Thylacine2.htm. Retrieved 21 November 2006. 
  27. ^ a b Sally Bryant and Jean Jackson Threatened Species Unit, Parks and Wildlife Service, Tasmania (1999) (PDF). Tasmania's Threatened Fauna Handbook. Bryant and Jackson. pp. 190–193. ISBN 0-7246-6223-5. http://www.dpiw.tas.gov.au/inter.nsf/Attachments/RLIG-5425ZR/$FILE/threatfauna.pdf. 
  28. ^ Menna Jones (1997-12). "Character displacement in Australian dasyurid carnivores: size relationships and prey size patterns". Ecology (Ecological Society of America) 78 (8): 2569. doi:10.1890/0012-9658(1997)078[2569:CDIADC]2.0.CO;2. http://www.findarticles.com/p/articles/mi_m2120/is_n8_v78/ai_20608534/pg_1. Retrieved 27 November 2006. 
  29. ^ The scrotal pouch is almost unique within the marsupials – the only other marsupial species to have this feature is the water opossum, Chironectes minimus which is found in Mexico, Central and South America.
  30. ^ AFP (21 October 2003). "Extinct Thylacine May Live Again". Discovery Channel. http://animal.discovery.com/news/afp/20031020/thylacine.html. Retrieved 28 November 2007. 
  31. ^ a b Tasmanian Tiger's Jaw Was Too Small to Attack Sheep, Study Shows Science Daily September 1, 2011
  32. ^ a b c d e f "Wildlife of Tasmania: Mammals of Tasmania: Thylacine, or Tasmanian tiger, Thylacinus cynocephalus". Parks and Wildlife Service, Tasmania. 2006. http://www.parks.tas.gov.au/wildlife/mammals/thylacin.html. Retrieved 21 November 2006. 
  33. ^ Paddle (2000). p.49
  34. ^ "Tasmanian Tiger". Archives Office of Tasmania. 1930. http://portal.archives.tas.gov.au/menu.aspx?detail=1&type=i&id=1084. Retrieved 27 November 2006. 
  35. ^ Paddle (2000). p.65–66
  36. ^ "Mummified thylacine has national message". National Museum of Australia, Canberra. 16 June 2004. http://www.nma.gov.au/media/media_releases_by_year/2012/2004_06_16. Retrieved 21 November 2006. [dead link]
  37. ^ a b "Australia's Thylacine: Where did the Thylacine live?". Australian Museum. 1999. http://www.amonline.net.au/thylacine/04.htm. Retrieved 21 November 2006. 
  38. ^ Paddle (2000). p.42–43
  39. ^ Paddle (2000). p.38–39
  40. ^ a b Heberle, G. (1977). "Reports of alleged thylacine sightings in Western Australia" (w). Sunday Telegraph [Sydney]: 46. http://freepages.genealogy.rootsweb.ancestry.com/~gregheberle/AdobePDF/Thylacine/ThylacinePaper2004-P1-5.pdf. 
  41. ^ Tasmanian tigers brough to life, Australian Geographic, 24 February 2011.
  42. ^ Paddle (2000). p.60
  43. ^ Paddle (2000). p.228–231
  44. ^ Some writers go further to postulate that the mature thylacine's jaw and bipedal hop were specialised for hunting the emu and either breaking its neck or severing the jugular vein.
  45. ^ Paddle (2000). p.81
  46. ^ Pople, A. R., G. C. Grigg, S. C. Cairns, L. A. Beard and P. Alexander (2000). "Trends in the numbers of red kangaroos and emus on either side of the South Australian dingo fence: evidence for predator regulation?". Wildlife Research 27 (3): 269–276. doi:10.1071/WR99030. 
  47. ^ "Emu". http://www.blueplanetbiomes.org/emu.htm. Retrieved 19 September 2006. 
  48. ^ Based on the lack of reliable first hand accounts, Robert Paddle argues that the predation on sheep and poultry may have been exaggerated, suggesting the thylacine was used as a convenient scapegoat for the mismanagement of the sheep farms, and the image of it as a poultry killer impressed on the public consciousness by a striking photo taken by Henry Burrell in 1921.
  49. ^ Paddle (2000) p.79–138
  50. ^ Paddle (2000). p.29–35
  51. ^ Paddle (2000). p.96
  52. ^ Paddle (2000). p.32
  53. ^ Tasmanian tiger was no sheep killer ABC Science September 1, 2011
  54. ^ However reliable accounts of thylacine survival in South Australia (though confined to the 'thinly settled districts' and Flinders Ranges) and New South Wales (Blue Mountains) exist from as late as the 1830s, from both indigenous and European sources.
  55. ^ Paddle (2000) p.23–24
  56. ^ "Introducing the Thylacine". The Thylacine Museum. http://www.naturalworlds.org/thylacine/introducing/tasmanian_wolf_4.htm. Retrieved 23 May 2007. 
  57. ^ "Tiger's demise: dingo did do it – National – smh.com.au". Sydney Morning Herald. 6 September 2007. http://www.smh.com.au/news/national/tigers-demise-dingo-did-do-it/2007/09/05/1188783320057.html. Retrieved 3 November 2008. 
  58. ^ Paddle (2000) Plate 2.1 p.19
  59. ^ Carol Freeman (2005-06). "Is this picture worth a thousand words? An analysis of Henry Burrell's photograph of a thylacine with a chicken" (PDF). Australian Zoologist 33 (1). http://www.carnivoreconservation.org/files/issues/thylacine_picture_worth.pdf. 
  60. ^ James Boyce (2006). "Canine Revolution: The Social and Environmental Impact of the Introduction of the Dog to Tasmania". Environmental History 11 (1). http://www.historycooperative.org/journals/eh/11.1/boyce.html. Retrieved 21 November 2006. 
  61. ^ Paddle (2000). p.202–203
  62. ^ a b "Pelt of a thylacine shot in the Pieman River-Zeehan area of Tasmania in 1930: Charles Selby Wilson collection". National Museum of Australia, Canberra. http://www.nma.gov.au/collections/highlights/thylacine. Retrieved 9 January 2012. 
  63. ^ "Additional Thylacine Topics: Persecution". The Thylacine Museum. 2006. http://www.naturalworlds.org/thylacine/additional/persecution/image_6.htm. Retrieved 27 November 2006. 
  64. ^ Paddle (2000) p.198–201
  65. ^ Paddle was unable to uncover any records of any Frank Darby been employed by Beaumaris/Hobart Zoo during the time that Reid or her father were in charge, and noted several inconsistencies in the story Darby told during his interview in 1968.
  66. ^ Paddle (2000). p195
  67. ^ Leigh Dayton (19 May 2001). "Rough Justice". New Scientist. http://www.newscientist.com/article/mg17022915.100. Retrieved 15 February 2010. 
  68. ^ Fleay was bitten on the buttock whilst shooting the film, having ignored the threat yawn and hissing vocalisations made by the animal.
  69. ^ "National Threatened Species Day". Department of the Environment and Heritage, Australian Government. 2006. http://www.environment.gov.au/biodiversity/threatened/ts-day/index.html. Retrieved 21 November 2006. 
  70. ^ Paddle (2000). p.184
  71. ^ Park, Andy (July 1986). Tasmanian Tiger- Extinct or merely elusive?. 1. Australian Geographic. pp. 66–83. 
  72. ^ "Appendices I, II and III". Convention on International Trade in Endangered Species of Wild Fauna and Flora. 22 May 2009. Archived from the original on 4 February 2010. http://web.archive.org/web/20100204020215/http://www.cites.org/eng/app/appendices.shtml. Retrieved 15 February 2010. 
  73. ^ "ARFRA Information/FAQ". Australian Rare Fauna Research Association. 2003. http://arfra.webs.com/informationfaq.htm. Retrieved 2 February 22 November 2006. 
  74. ^ Buck Emburg and Joan Emburg. "Thylacine Sightings Map". Tasmanian-tiger.com. http://www.tasmanian-tiger.com/sightings.htm. Retrieved 22 November 2006. 
  75. ^ "Thyla seen near CBD?". The Sydney Morning Herald. 18 August 2003. http://www.smh.com.au/news/Tassie-Tiger/Thyla-seen-near-CBD/2003/08/18/1061059765660.html. Retrieved 15 February 2010. 
  76. ^ Phil Hall (16 February 2007). "The Bootleg Files: "Footage of the Last Thylacine"". Film Threat. http://www.filmthreat.com/index.php?section=features&Id=1886. Retrieved 14 February 2009. 
  77. ^ "Mystery that burns so bright". The Sydney Morning Herald. 9 May 2000. http://www.smh.com.au/news/Tassie-Tiger/Mystery-that-burns-so-bright/2002/09/25/1032734210053.html. Retrieved 15 February 2010. 
  78. ^ James Woodford (30 January 1995). "New bush sighting puts tiger hunter back in business". The Sydney Morning Herald. http://www.smh.com.au/news/Tassie-Tiger/New-bush-sighting-puts-tiger-hunter-back-in-business/2002/09/25/1032734216943.html. Retrieved 21 November 2006. 
  79. ^ Dingoes, the thylacine's possible competitor, are now rare, if not extinct, in Western New Guinea.
  80. ^ Corbett, L.K (2004). "IUCN Red List: Canis lupus ssp. dingo". IUCN. http://www.iucnredlist.org/search/details.php/41585/doc. Retrieved 21 November 2006. 
  81. ^ Louise Williams (15 April 1997). "Tassie tiger sighting claim in Irian Jaya". The Sydney Morning Herald. http://www.smh.com.au/news/tassie-tiger/tassie-tiger-sighting-claim-in-irian-jaya/2002/09/25/1032734218360.html. Retrieved 21 November 2006. 
  82. ^ "Tourist claims to have snapped Tasmanian tiger". The Sydney Morning Herald. 1 March 2005. http://www.smh.com.au/news/National/Tourist-claims-to-have-snapped-Tasmanian-tiger/2005/03/01/1109546854027.html?oneclick=true. Retrieved 21 November 2006. 
  83. ^ a b c Daniel Dasey (15 May 2005). "Researchers revive plan to clone the Tassie tiger". Sydney Morning Herald. http://www.smh.com.au/news/Science/Clone-again/2005/05/14/1116024405941.html. Retrieved 22 November 2006. 
  84. ^ a b Jason Steger (26 March 2005). "Extinct or not, the story won't die". The Age (Melbourne). http://www.theage.com.au/news/Science/Extinct-or-not-the-story-wont-die/2005/03/25/1111692630378.html. Retrieved 22 November 2006. 
  85. ^ Murray McAllister (2000). "Reward Monies Withdrawn". http://net.pembrokesc.vic.edu.au/home/tiger/expd5.html. Retrieved 22 November 2006. [dead link]
  86. ^ Julia Leigh (30 May 2002). "Back from the dead". The Guardian (London). http://www.guardian.co.uk/Archive/Article/0,4273,4424142,00.html. Retrieved 22 November 2006. 
  87. ^ "Tasmanian tiger clone a fantasy: scientist". Melbourne Age. 22 August 2002. http://www.theage.com.au/articles/2002/08/21/1029114134051.html. Retrieved 28 December 2006. 
  88. ^ "Attempting to make a genomic library of an extinct animal". Australian Museum. 1999. http://www.amonline.net.au/thylacine/summary.htm. Retrieved 22 November 2006. 
  89. ^ "Museum ditches thylacine cloning project". ABC News Online. 15 February 2005. http://www.abc.net.au/news/newsitems/200502/s1303501.htm. Retrieved 22 November 2006. [dead link]
  90. ^ Deborah Smith (17 February 2005). "Tassie tiger cloning 'pie-in-the-sky science'". Sydney Morning Herald. http://www.smh.com.au/news/science/tassie-tiger-cloning-pieinthesky-science/2005/02/16/1108500157295.html. Retrieved 22 November 2006. 
  91. ^ Judy Skatssoon (15 February 2005). "Thylacine cloning project dumped". ABC Science Online. http://www.abc.net.au/science/news/stories/s1302459.htm. Retrieved 22 November 2006. 
  92. ^ Skins occasionally turn up in private ownership, such as the Wilson skin purchased by the National Museum of Australia in 1987.
  93. ^ Pask AJ, Behringer RR, Renfree MB (2008). Svensson, Erik I.. ed. "Resurrection of DNA function in vivo from an extinct genome". PLoS ONE 3 (5): e2240. doi:10.1371/journal.pone.0002240. PMC 2375112. PMID 18493600. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2375112. 
  94. ^ Tasmanian tiger gene lives again Nature News 20 May 2008
  95. ^ a b University Librarian (24 September 2007). "The Exotic Thylacine". Imaging the Thylacine. University of Tasmania. http://www.utas.edu.au/library/exhibitions/thylacine/exotic.html. Retrieved 30 April 2009. 
  96. ^ Stephens, Matthew; Robyn Williams (13 June 2004). "John Gould's place in Australian culture". Ockham's Razor. Australian Broadcasting Corporation. http://www.abc.net.au/rn/ockhamsrazor/stories/2004/1130006.htm. Retrieved 28 April 2009. [dead link]
  97. ^ Government Tourist Bureau, Tasmania. Tasmania: The Wonderland. Hobart: Government Printer, Tasmania, 1934
  98. ^ a b c d "Imaging the Thylacine". University of Tasmania. 24 September 2007. http://www.utas.edu.au/library/exhibitions/thylacine/official.html. Retrieved 13 April 2010. 
  99. ^ Philip R. Burns (6 July 2003). "Thylacine Stamps". http://www.pibburns.com/cryptost/thylacin.htm. Retrieved 21 November 2006. 
  100. ^ "The Hunter". The Hunter. Penguin Books Australia. 2011-10-19. http://www.penguin.com.au/products/9780140283518/hunter. Retrieved 5 February 2012. 

References

  • Guiler, E. (1985). Thylacine: The Tragedy of the Tasmanian Tiger. Oxford University Press. ISBN 0-19-554603-2
  • Guiler, E. & Godard, P. (1998). Tasmanian Tiger: A lesson to be learnt. Abrolhos Publishing. ISBN 0-9585791-0-5
  • Guiler, E. R. (1961a). "Breeding season of the Thylacine". Journal of Mammalogy 42(3): 396–397.
  • Guiler, E. R. (1961b). "The former distribution and decline of the Thylacine". Australian Journal of Science 23(7): 207–210.
  • Lord, C. (1927). "Existing Tasmanian marsupials". Papers and Proceedings of the Royal Society of Tasmania 61: 17–24.
  • Lowry, D. C. (1967). "Discovery of a Thylacine (Tasmanian Tiger) Carcase In a Cave Near Eucla, Western Australia". Helictite.
  • Paddle, R. (2000). The Last Tasmanian Tiger: The History and Extinction of the Thylacine. Cambridge University Press. ISBN 0-521-53154-3 Available online at [1]
  • Park, A. (1986). "A Tasmanian Tiger Extinct or Merely Elusive". Australian Geographic 1(3): 66–83.
  • Pearce, R (1976). "Thylacines in Tasmania". Australian Mammal Society Bulletin 3: 58.
  • Sleightholme, S. & Ayliffe, N. (2005). International Thylacine Specimen Database. CD-Rom. Master Copy: Zoological Society, London
  • Smith, S. J. (1980). "The Tasmanian Tiger – 1980. A report on an investigation of the current status of thylacine Thylacinus cynocephalus, funded by the World Wildlife Fund Australia". Hobart: National Parks and Wildlife Service, Tasmania.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!