Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

Biology

Shrews are well known for their voracious appetites (3); the common shrew has to eat every 2-3 hours and needs to consume 80 to 90% of their body weight in food in 24-hours (3). They feed on most terrestrial insects, but will also take worms, slugs and snails (2). The common shrew is more active during the night, at dusk, and at dawn, and intersperses bursts of activity with rest periods (3). Shrews do not hibernate, as they are too small to store fat reserves sufficient to see them through the winter (3). This solitary species is territorial (2), but during the breeding season males set off in search of females. His advances may stimulate scuffles and high-pitched squeaks from unreceptive females (3). Mating begins in March, and 1-2 (sometimes 3 or 4) litters are produced in a year, each one consisting of 6-7 young (5). By 16 days of age the young begin to emerge from the nest, they can occasionally be seen following their mother around in a 'caravan', usually after the nest has been disturbed. The young grab the tail of the shrew in front of it, so the mother takes the lead and her offspring follow in a train (3). Juveniles breed in the year after their birth, but occasionally those born early in the year can breed between July and September that year (5). Common shrews live for 14-19 months, and mortality rates are high; main predators include owls, birds of prey, foxes, cats and stoats and weasels (5). Shrews belonging to the genus Sorex are known to produce ultrasound, which may be used as a primitive form of echolocation (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The common shrew, one of Britain's most abundant mammals has a long, flexible snout, tiny ears and small eyes typical of most shrews (2). The fur is dark brown on the back, with paler brown flanks and a pale belly (1). Juveniles have lighter fur until they undergo their first moult, after which their winter coat grows (3). This species is a 'red-toothed shrew'; iron is deposited in the enamel of the crowns of the teeth, making them more resistant to wear-and-tear (3). The Latin name araneus means 'spider'; this refers to the old belief that shrews were poisonous, like spiders.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common shrews are common on the mainland, but are not found on most Wadden Islands. You will only find them on Terschelling, Borkum and Baltrum. They are active day and night and have a high metabolism. Every day, they must eat one and a half times their body weight. Their food consists of beetles, slaters, worms, spiders, snails, carrion and seeds from conifers. Common shrews have a good sense of smell and can find food ten centimeters deep under the ground.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Range Description

The common shrew has a wide distribution in the Palaearctic, occurring from Britain through central, northern and eastern Europe and Asia as far east as Lake Baikal and as far north as the Arctic coast. It is widespread throughout, with the exception of arid steppe and desert areas. In the Mediterranean, it occurs in most European continental areas, with the exception of large parts of Iberia, France, and Italy and the Balkans. There are isolated populations in the Pyrenees and the Massif Central (France). It is recorded from sea level to 2,500 m (Andĕra 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Sorex araneus is found in Europe, including Great Britain and the Pyrenees. The extent of its range to the east is Lake Baikal, except in the dry steppes and desert zone. It is not found in Iberia, or most of France.(Mitchell-Jones 1999, Stone 1995)

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Distributed throughout mainland Britain, as well as on many offshore islands. The common shrew also occurs throughout most of Europe but is absent from Ireland and the Mediterranean (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Sorex araneus has a tricolored coat. The ventral side is grayish, and the dorsal side varies in color from black to reddish brown. Its flanks are nut brown. Its tail is brown on the dorsal side, and gray ventrally. It has small eyes and it ears are hidden in fur. It has red-tipped teeth.(Mitchell-Jones 1990, Stone 1995)

Range mass: 5 to 14 g.

Range length: 48 to 80 mm.

Average basal metabolic rate: 0.348 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Sorex araneus
Catalog Number: USNM 85930
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): J. Loring
Year Collected: 1898
Locality: Meiringen, Bern, Switzerland, Europe
  • Type: Miller. 1901 Apr 25. Proc. Biol. Soc. Wash. 14: 43.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Sorex araneus
Catalog Number: USNM 84664
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): T. Stejneger
Year Collected: 1898
Locality: Granvin, Hardanger, Granvin Municipality, Hordaland, Norway, Europe
  • Type: Miller, G. S. 1909 May. Ann. Mag. Nat. Hist., (Ser. 8). 3: 416.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It prefers cool, damp and shady habitats with dense vegetation, such as riparian forests and reed beds (Hausser et al. 1990). However, it tolerates a broad range of habitats, and it is present (albeit at lower densities) in drier areas such as woodland, scrub, road verges, hedges in farmland, and even sand dunes (Andĕra 1999). It is absent from very arid habitats. It feeds largely on invertebrates, especially arthropods, earthworms, and snails, but it also feeds on vegetative matter (Hausser et al. 1990).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sorex araneus lives in variable habitats. These include woodlands, grassland, dunes, scree, heath, and hedgerows. It can live as far as the limits of the summer snow line.(Parker 1990)

Habitat Regions: temperate

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits a huge variety of habitats where there is good vegetation cover, including 'edge' habitats such as road verges (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

It is an opportunistic feeder that preys upon many insects, woodlice, spiders, and earthworms. (Cove et al. 2000)

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
fluke of Brachylaimus oesophagei endoparasitises stomach of Sorex araneus

Animal / rests in
encapsulated cystacanth of Centrorhynchus aluconis rests inside mesentery of Sorex araneus

Animal / parasite / endoparasite
tapeworm of Choanotaenia crassiscolex endoparasitises small intestine of Sorex araneus

Animal / parasite / ectoparasite / blood sucker
Hystrichopsylla talpae talpae sucks the blood of Sorex araneus
Other: minor host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Sorex araneus makes burrows below ground, and also uses the burrows of mice, voles, and moles. (Stone 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There are a number of predators of Sorex araneus, as listed below. (Kristofik 1999, Parker 1990)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Sorex araneus is prey of:
Reptilia
Strigiformes
Mustela
Tyto alba
Mustela erminea
Felis silvestris
Vulpes vulpes
Strix aluco

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Sorex araneus preys on:
non-insect arthropods

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Sorex araneus can live for about 2 years. (Mitchell-Jones 1990)

Average lifespan

Status: captivity:
2 years.

Average lifespan

Status: wild:
2.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 3.2 years (captivity) Observations: In the wild, these animals rarely live more than one year. One captive specimen lived for 3.2 years (Richard Weigl 2005). In one study in captivity, animals featured a high mortality, though inadequate husbandry conditions could be to blame (Pucek 1964).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Gestation takes place for 19-21 days. Young are born weighing between 0.5-0.6 grams. The young are weaned after 26-30 days, and reach sexual maturity at 9 or 10 months.(Parker 1990, Mitchell-Jones 1999)

Range gestation period: 19 to 21 days.

Range weaning age: 26 to 30 days.

Range age at sexual or reproductive maturity (female): 9 to 10 months.

Range age at sexual or reproductive maturity (male): 9 to 10 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 0.44 g.

Average number of offspring: 6.

Parental Investment: altricial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sorex araneus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGGATAAATAATATAAGCTTCTGACTACTCCCGCCATCATTTCTTCTATTACTAGCCTCATCAACCGTCGAAGCAGGGGCAGGTACCGGCTGAACTGTCTACCCCCCATTGGCCGGCAATCTAGCCCATGCAGGAGCATCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGCGTTTCATCCATTCTAGGGTCAATCAATTTCATTACCACAATTATTAATATGAAACCCCCTGCTATGTCTCAATATCAAACACCATTATTCGTATGATCAGTCCTAATTACAGCAGTACTTCTACTTCTTTCACTTCCAGTTCTTGCAGCCGGTATTACTATACTTTTAACAGATCGTAATCTTAATACTACTTTCTTTGACCCTGCCGGAGGTGGAGATCCAATTCTTTATCAACACCTTTTCTGATTCTTTGGGCACCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sorex araneus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 47
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutterer, R., Amori, G. & Kryštufek, B.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Justification
S. araneus has a very wide range and is one of the commonest shrew species throughout its range. Although general habitat degradation may affect localised populations, this is not considered a serious threat to the global population. Least Concern.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The main threat to Sorex araneus is by habitat destruction through road construction and development in Europe(Stone 1995).

The common shrew in England is protected by the Wildlife and Countryside Act (1981) and cannot trapped without a license (The Mammal Society 2001).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Partially protected in the UK under Schedule 6 of the Wildlife and Countryside Act, 1981 (3). Listed under Schedule III of the Bern Convention, and classified as a Species of Conservation Concern under the UK Biodiversity Action Plan, although not a priority species (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is one of the most abundant shrew species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Threats include general habitat degradation and an indirect threat from pesticides and pollutants (accumulation of toxins through their diet). In some countries (but not in the Mediterranean), this is an indicator species for monitoring terrestrial pollution. However, the species is not considered seriously affected by these threats at a regional or global level.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In farmland areas, this species is likely to be affected by pesticides, either through secondary contamination through their prey or by direct exposure (5). Decreases in prey availability can greatly affect survival as shrews have such high metabolic rates (5). The decline in hedgerows, field boundaries and other features that provide important habitats for shrews resulting from agricultural changes may also affect shrews (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on Appendix III of the Bern Convention, and it occurs in many protected areas. No specific conservation actions are recommended at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

All shrews are protected under schedule 6 of the Wildlife and Countryside Act 1981; under this act it is illegal to trap shrews without a licence (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Sorex araneus eats helpful invertebrates such as earthworms and spiders.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There may be some pest invertebrates in the diet of Sorex araneus.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common shrew

The common shrew (Sorex araneus) or Eurasian shrew is the most common shrew, and one of the most common mammals, throughout Northern Europe, including Great Britain, but excluding Ireland. It is 55–82 millimetres (2.2–3.2 in) long and weighs 5–12 grams (0.2–0.4 oz), and has velvety dark brown fur with a pale underside. Juvenile shrews have lighter fur until their first moult. The Common Shrew has small eyes, a pointed, mobile snout, and red-tipped teeth. It has a life span of approximately 14 months.

Shrews are active day and night, but mostly after dark. They are active most of the time, resting for only a few minutes between burst of activity.

Contents

Territory [edit]

The common shrew is found in the woodlands, grasslands, and hedgelands of Britain, Scandinavia, and Eastern Europe. Each shrew establishes a home range of 370–630 square metres (440–750 sq yd). Males extend these boundaries only during breeding season, to find females. The common shrew is extremely territorial and becomes aggressive when another shrew enters its home range. It makes its nest underground or under dense vegetation.[3]

Diet [edit]

The shrew's carnivorous and insectivorous diet consists mostly of insects, slugs, spiders, small mice and worms. Shrews need to consume 200-300% of their body weight each day in order to survive. A shrew must eat every two to three hours to achieve this goal. This means that a shrew may starve if it finds no food for as little as 5 hours. They do not hibernate in the winter months because their bodies are too small to hold sufficient fat reserves.[citation needed]

Shrews have poor eyesight, but use their excellent sense of smell and good hearing to locate food. Using these senses, a shrew can locate prey up to 12 centimetres (5 in) deep in the soil.[citation needed]

Breeding [edit]

The common shrew breeding season lasts from April to September, but peaks during the summer months. After a gestation period of 24 to 25 days, a female gives birth to a litter of five to seven baby shrews. A female usually rears two to four litters each year. The young are weaned and independent by 22 to 25 days.[4]

Breeding is the only time that shrews do not prefer to be solitary. Young shrews often form a caravan behind the mother, each carrying the tail of the sibling in front with its mouth.

Chromosomal polymorphism [edit]

The chromosome number (karyotype) of Sorex araneus varies widely, with a number of distinct "chromosomal races" being present over the species' range.[2] One such race was described in 2002 as a new species, S. antinorii.[2] This is an example of chromosomal polymorphism;[5] the variability occurs as a result of chromosome fusions or disassociations.[6]

Protection and population [edit]

Common & Eurasian Pygmy Shrews (genus Sorex), size comparison

The common shrew is not an endangered species, but in Great Britain it, like other shrews, is protected from certain methods of killing by the Wildlife and Countryside Act of 1981.[7]

In Britain, shrews can be found at densities up to one per 200 square metres (240 sq yd) in woodlands. The population is controlled by many predators including owls, weasels, stoats, and foxes. A liquid produced by glands on the skin makes shrews taste rather unpleasant to domestic cats.[3]

References [edit]

  1. ^ Hutterer, R. (2005). "Order Soricomorpha". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 283. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c Hutterer, R., Amori, G. & Kryštufek, B. (2008). "Sorex araneus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 31 December 2011. 
  3. ^ a b British Wildlife. London: Collins. 2002. p. 402. ISBN 0 00 713716 8. 
  4. ^ "BBC Science and Nature: Animals". Retrieved 11 September 2009. 
  5. ^ Polymorphism: when two or more clearly different phenotypes exist in the same interbreeding population of a species. Ford E.B. 1975. Ecological genetics, 4th ed.
  6. ^ White M.J.D. 1973. The chromosomes. Chapman & Hall, London. p169
  7. ^ Wildlife and Countryside Act 1981 S11, Sch 6
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!