Articles on this page are available in 1 other language: Spanish (1) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Panthera tigris tigris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGCTGACTATTTTCAACCAATCACAAGGATATTGGAACTCTTTACCTTTTATTTGGCGCCTGGGCTGGTATGGTGGGGACTGCCCTCAGTCTCCTAATTCGAGCCGAACTGGGTCAACCTGGCACACTACTAGGAGATGACCAAATTTATAATGTAGTAGTTACTGCCCATGCCTTTGTGATAATCTTTTTTATAGTAATGCCTATTATAATTGGAGGATTCGGAAACTGGCTAGTTCCGTTAATAATCGGAGCCCCCGATATGGCATTCCCTCGAATGAATAACATAAGCTTCTGACTCCTTCCCCCATCCTTCCTACTTCTGCTCGCATCGTCTATGGTAGAAGCTGGGGCAGGAACTGGGTGGACAGTATACCCACCCCTAGCTGGCAACCTAGCCCATGCAGGAGCATCCGTGGATCTAACTATTTTTTCACTACACCTAGCAGGCGTCTCCTCAATCTTAGGTGCTATTAATTTTATTACTACTATTATTAATATAAAACCGCCCGCTATGTCCCAATACCAAACGCCCCTGTTTGTTTGATCGGTTCTAATTACTGCTGTGTTGCTACTTCTATCACTGCCAGTTTTAGCAGCAGGCATCACCATGCTACTGACAGATCGAAATCTAAATACCACATTTTTTGATCCTGCCGGGGGAGGAGACCCCATCTTATATCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTATATCTTAATCCTGCCCGGGTTTGGAATAATTTCACATATTGTCACCTACTACTCAGGCAAAAAAGAACCTTTTGGCTACATGGGGATAGTCTGAGCCATAATGTCAATTGGCTTTCTGGGCTTTATCGTATGGGCCCATCACATGTTTACTGTAGGGATAGATGTGGATACACGAGCATACTTTACGTCAGCTACTATAATTATCGCTATTCCTACTGGGGTAAAAGTATTTAGCTGATTGACCACTCTTCACGGGGGTAATATTAAATGGTCTCCCGCTATACTATGGGCTTTGGGATTCATTTTCCTATTCACCGTAGGGGGCTTAACAGGAATTGTATTAGCAAACTCCTCATTGGATATTGTCCTTCACGACACATACTACGTAGTAGCCCACTTCCACTACGTCTTGTCAATAGGAGCAGTATTTGCTATCATAGGGGGCTTCGTTCACTGATTCCCCTTATTCTCAGGGTATACTCTTGATAATACTTGGGCAAAAGTTCATTTTACGATCATGTTCGTAGGTGTCAATATAACGTTTTTCCCTCAGCATTTCCTAGGCCTGTCTGGGATGCCTCGACGTTATTCTGACTATCCAGACGCGTATACAACTTGAAACACAATCTCCTCAATAGGCTCTTTTATTTCACTAACAGCAGTAATATTAATAGTCTTTATAGTGTGAGAAGCTTTCGCATCAAAGCGAGAAGTAGCCACAGTGGAACTAACCACAACTAATCTCGAATGACTTCACGGATGTCCTCCTCCGTATCACACATTTGAAGAGCCAGCCTACGTGCTGTTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Panthera tigris tigris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bcd+4bcd;C1+2a(i)

Version
3.1

Year Assessed
2011

Assessor/s
Chundawat, R.S., Khan, J.A. & Mallon, D.P.

Reviewer/s
Nowell, K., Breitenmoser-Wursten, C., Breitenmoser, U. & Schipper, J.

Contributor/s

Justification
Most Bengal Tigers are found in India, which has recently revamped its national tiger census methodology to be more scientific, extrapolating site-specific densities derived from camera trap and sign surveys using GIS. The 2010 survey resulted in an estimated population of 1,706 (1,520–1,909) (Jhala et al. 2011), an increase from 1,411 in 2006 (Jhala et al. 2008). The increase is in part due to inclusion of new areas in the most recent survey (Sunderbans, some portions of North East and parts of Maharashtra), but tiger densities were found to have increased in areas of Uttarakhand, Tamil Nadu, Maharashtra and Karnataka. However, the survey found a decrease in tiger range of 12.6% in connecting habitat corridors from 2006–2010 (Jhala et al. 2011).

Other Bengal Tiger population estimates from national governments for the Global Tiger Recovery Program include Bangladesh (440), Nepal (155) and Bhutan (75). The total subspecies population is estimated at fewer than 2,500 tigers (2,376). No subpopulation is larger than 250. There has been a continuing decline over the past three tiger generations (20–30 years). The previous national India tiger census result of 3,642 in 2001–2002 cannot be directly compared to more recent surveys, as a different and somewhat discredited methodology was employed (attempting to identify individual tigers on the basis of unique pugmarks, or tracks). Nonetheless, a substantial decline in India's Tiger population is suggested.

Sanderson et al. (2006) built upon previous work by Dinerstein et al. (1997) to map priority landscapes for tigers (Tiger Conservation Landscapes). The Tiger's extent of occupied area is estimated at less than 1,184,911 km² (Sanderson et al. 2006), a 41% decline from the area estimated by Dinerstein et al. (1997). India suffered the most range contraction. While part of the difference is due to improved data after a decade of intensive tiger conservation efforts, and improved datasets and techniques, biologists consider the primary cause to be declines due to poaching and habitat loss (Dinerstein et al. 2007). Range decline is considered a strong indicator of population decline (Dinerstein et al. 2007). Because an average of 55% of Tiger Conservation Landscapes consist of non-tiger habitat (Sanderson et al. 2006), the declines in population and area of occupancy are greater than the 41% estimated, and thus likely indicate a 50% or greater reduction. A similar reduction could be expected over the next three tiger generations (20–30 years) unless conservation effort becomes more effective.

History
  • 2010
    Endangered
    (IUCN 2008)
  • 2010
    Endangered
    (IUCN 2010.2)
  • 2008
    Endangered
    (IUCN 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bengal tiger

The Bengal tiger (Panthera tigris tigris) is the most numerous tiger subspecies. Its populations have been estimated at 1,706–1,909 in India, 440 in Bangladesh, 124–229 in Nepal and 67–81 in Bhutan.[2][3][4][5] Since 2010, it has been classified as an endangered species by the IUCN. The total population is estimated at fewer than 2,500 individuals with a decreasing trend, and none of the Tiger Conservation Landscapes within the Bengal tiger's range is large enough to support an effective population size of 250 adult individuals.[1]

A Bengal tiger at Bannerghatta National Park, India

Bengal is traditionally fixed as the typical locality for the binomial Panthera tigris, to which the British taxonomist Pocock subordinated the Bengal tiger in 1929 under the trinomial Panthera tigris tigris.[6][7]

It is the national animal of both India and Bangladesh.[8]

Contents

Characteristics [edit]

A Bengal tiger in Mangalore, Karnataka

The Bengal tiger's coat is yellow to light orange, with stripes ranging from dark brown to black; the belly and the interior parts of the limbs are white, and the tail is orange with black rings.

Male Bengal tigers have an average total length of 270 to 310 cm (110 to 120 in) including the tail, while females measure 240 to 265 cm (94 to 104 in) on average.[9] The tail is typically 85 to 110 cm (33 to 43 in) long, and on average, tigers are 90 to 110 cm (35 to 43 in) in height at the shoulders.[10] The average weight of males is 221.2 kg (488 lb), while that of females is 139.7 kg (308 lb).[11] The smallest recorded weights for Bengal tigers are from the Bangladesh Sundarbans, where adult females are 75–80 kg (170–180 lb).[12]

A white Bengal tiger at the Cougar Mountain Zoo

The white tiger is a recessive mutant of the Bengal tiger, which is reported in the wild from time to time in Assam, Bengal, Bihar and especially from the former State of Rewa. However, it is not to be mistaken as an occurrence of albinism. In fact, there is only one fully authenticated case of a true albino tiger, and none of black tigers, with the possible exception of one dead specimen examined in Chittagong in 1846.[13]

Records [edit]

Two tigers shot in Kumaon and near Oude at the end of the 19th century allegedly measured more than 12 ft (370 cm). But at the time, sportsmen had not yet adopted a standard system of measurement; some would measure between pegs while others would round the curves.[14]

In the beginning of the 20th century, a male Bengal tiger was shot in central India with a head and body length of 221 cm (87 in) between pegs, a chest girth of 150 cm (59 in), a shoulder height of 109 cm (43 in) and a tail length of 81 cm (32 in), which was perhaps bitten off by a rival male. This specimen could not be weighed, but it was calculated to weigh no less than 272 kg (600 lb).[15]

A heavy male weighing 570 lb (260 kg) was shot in northern India in the 1930s.[16] However, the heaviest known tiger was a huge male killed in 1967 that weighed 388.7 kg (857 lb) and measured 322 cm (127 in) in total length between pegs, and 338 cm (133 in) over curves. This specimen is on exhibition in the Mammals Hall of the Smithsonian Institution.[17] In 1999 and 1990, scientists captured and tagged two male tigers in Chitwan National Park that weighed more than 270 kg (600 lb).[18]

Genetic ancestry [edit]

Bengal tigers are defined by three distinct mitochondrial nucleotide sites and 12 unique microsatellite alleles. The pattern of genetic variation in the Bengal tiger corresponds to the premise that they arrived in India approximately 12,000 years ago.[19] This is consistent with the lack of tiger fossils from the Indian subcontinent prior to the late Pleistocene and the absence of tigers from Sri Lanka, which was separated from the subcontinent by rising sea levels in the early Holocene.[20]

Distribution and habitat [edit]

White Royal Bengal Tiger (Dilbag) of Chandigarh Zoo, India.
A Bengal tigress with her cubs at the Bandhavgarh National Park, India

In 1982, a sub-fossil right middle phalanx was found in a prehistoric midden near Kuruwita in Sri Lanka, which is dated to about 16,500 ybp and tentatively considered to be of a tiger. Tigers appear to have arrived in Sri Lanka during a pluvial period during which sea levels were depressed, evidently prior to the last glacial maximum about 20,000 years ago.[21] In 1929, the British taxonomist Pocock assumed that tigers arrived in southern India too late to colonize Sri Lanka, which earlier had been connected to India by a land bridge.[6]

In the Indian subcontinent, tigers inhabit tropical moist evergreen forests, tropical dry forests, tropical and subtropical moist deciduous forests, mangroves, subtropical and temperate upland forests, and alluvial grasslands. Latter tiger habitat once covered a huge swath of grassland and riverine and moist semi-deciduous forests along the major river system of the Gangetic and Brahmaputra plains, but has now been largely converted to agriculture or severely degraded. Today, the best examples of this habitat type are limitated to a few blocks at the base of the outer foothills of the Himalayas including the Tiger Conservation Units (TCUs) Rajaji-Corbett, Bardia-Banke, and the transboundary TCUs Chitwan-Parsa-Valmiki, Dudhwa-Kailali and Sukla Phanta-Kishanpur. Tiger densities in these blocks are high, in part a response to the extraordinary biomass of ungulate prey.[22]

India [edit]

A Bengal tiger in Bannerghatta National Park, India

In the past, Indian censuses of wild tigers relied on the individual identification of footprints known as pug marks — a method that has been criticised as deficient and inaccurate, though now camera traps are being used in many places.[23]

Good tiger habitats in subtropical and temperate upland forests include the Tiger Conservation Units (TCUs) Manas-Namdapha. TCUs in tropical dry forest include Hazaribagh National Park, Nagarjunsagar-Srisailam Tiger Reserve, Kanha-Indravati corridor, Orissa dry forests, Panna National Park, Melghat Tiger Reserve and Ratapani Tiger Reserve. The TCUs in tropical moist deciduous forest are probably some of the most productive habitats for tigers and their prey, and include Kaziranga-Meghalaya, Kanha-Pench, Simlipal and Indravati Tiger Reserves. The TCUs in tropical moist evergreen forests represent the less common tiger habitats, being largely limited to the upland areas and wetter parts of the Western Ghats, and include the Tiger Reserves of Periyar, Kalakad-Mundathurai, Bandipur and Parambikulam Wildlife Sanctuary.[22]

The methodology used during the tiger census of 2008 extrapolates site-specific densities of tigers, their co-predators and prey derived from camera trap and sign surveys using GIS. Based on the result of these surveys, the total tiger population has been estimated at 1,411 individuals ranging from 1,165 to 1,657 adult and sub-adult tigers of more than 1.5 years of age. The following six landscape complexes comprising several ecological landscapes were surveyed across India based on current tiger occupancy and potential for connectivity:[24]

In May 2008, forest officials spotted 14 tiger cubs in Rajasthan's Ranthambore National Park.[25] In June 2008, a tiger from Ranthambore was relocated to Sariska Tiger Reserve, where all tigers had fallen victim to poachers and human encroachments since 2005.[26]

Bangladesh [edit]

Tigers in Bangladesh are now relegated to the forests of the Sundarbans and the Chittagong Hill Tracts.[27] The Chittagong forest is contiguous with tiger habitat in India and Myanmar, but the tiger population is of unknown status.[28]

As of 2004, population estimates in Bangladesh ranged from 200 to 419, mostly in the Sunderbans.[27][29] This region is the only mangrove habitat in this bioregion, where tigers survive, swimming between islands in the delta to hunt prey.[22] Bangladesh's Forest Department is raising mangrove plantations supplying forage for spotted deer. Since 2001, afforestation has continued on a small scale in newly accreted lands and islands of the Sundarbans.[3] From October 2005 to January 2007, the first camera-trap survey was conducted across six sites in the Bangladesh Sundarbans to estimate tiger population density. The average of these six sites provided an estimate of 3.7 tigers per 100 km2 (39 sq mi). Since the Bangladesh Sundarbans is an area of 5,770 km2 (2,230 sq mi) it was inferred that the total tiger population comprised approximately 200 individuals.[30] In another study, home ranges of adult female tigers were recorded comprising between 12 and 14 km2 (4.6 and 5.4 sq mi).,[31] which would indicate an approximate carrying capacity of 150 adult females.[32] The small home range of adult female tigers (and consequent high density of tigers) in this habitat type relative to other areas may be related to both the high density of prey and the small size of the Sundarbans tigers.[12]

Since 2007 tiger monitoring surveys have been carried out every year by WildTeam in the Bangladesh Sundarbans to monitor changes in the Bangladesh tiger population and assess the effectiveness of conservation actions. This survey measures changes in the frequency of tiger track sets along the sides of tidal waterways as an index of relative tiger abundance across the Sundarbans landscape.[33]

Nepal [edit]

The tiger population in the Terai of Nepal is split into three isolated subpopulations that are separated by cultivation and densely settled habitat. The largest population lives in Chitwan National Park and in the adjacent Parsa Wildlife Reserve encompassing an area of 2,543 km2 (982 sq mi) of prime lowland forest. To the west, the Chitwan population is isolated from the one in Bardia National Park and adjacent unprotected habitat further west, extending to within 15 km (9.3 mi) of the Sukla Phanta Wildlife Reserve, which harbours the smallest population.[34] The bottleneck between the Chitwan/Parsa and Bardia/Sukla Phanta metapopulations is situated just north of the town of Butwal.

As of 2009, an estimated 121 breeding tigers lived in Nepal.[35] By 2010, the number of adult tigers has reached 155.[4] A survey conducted from December 2009 to March 2010 indicates that 125 adult tigers live in Chitwan National Park and its border areas covering 1,261 km2 (487 sq mi).[36]

Bhutan [edit]

As of 2005, the population in Bhutan is estimated at 67–81 individuals.[5] Tigers occur from an altitude of 200 m (660 ft) in the subtropical Himalayan foothills in the south along the border with India to over 3,000 m (9,800 ft) in the temperate forests in the north, and are known from 17 of 18 districts. Their stronghold appears to be the central belt of the country ranging in altitude between 2,000 and 3,500 m (6,600 and 11,500 ft), between the Mo River in the west and the Kulong River in the east.[37] In 2010, camera traps recorded a pair of tigers at altitudes of 3,000 to 4,100 m (9,800 to 13,500 ft). The male was recorded scent-marking, and the female can also be seen to be lactating, confirming that the pair are living within their own territory, and strongly suggesting they are breeding at that altitude.[38]

Ecology and behaviour [edit]

A male and female Bengal tiger interact with each other.

The basic social unit of the tiger is the elemental one of mother and offspring. Adult animals congregate only on an ad hoc and transitory basis when special conditions permit, such as plentiful supply of food. Otherwise they lead solitary lives, hunting individually for the dispersed forest and tall grassland animals, upon which they prey. They establish and maintain home ranges. Resident adults of either sex tend to confine their movements to a definite area of habitat within which they satisfy their needs, and in the case of tigresses, those of their growing cubs. Besides providing the requirements of an adequate food supply, sufficient water and shelter, and a modicum of peace and seclusion, this location must make it possible for the resident to maintain contact with other tigers, especially those of the opposite sex. Those sharing the same ground are well aware of each other’s movements and activities.[13]

In the Panna Tiger Reserve an adult radio-collared male tiger moved 1.7 to 10.5 km (1.1 to 6.5 mi) between locations on successive days in winter, and 1 to 13.9 km (0.62 to 8.6 mi) in summer. His home range was about 200 km2 (77 sq mi) in summer and 110 km2 (42 sq mi) in winter. Included in his home range were the much smaller home ranges of two females, a tigress with cubs and a sub-adult tigress. They occupied home ranges of 16 to 31 km2 (6.2 to 12 sq mi).[39]

The home ranges occupied by adult male residents tend to be mutually exclusive, even though one of these residents may tolerate a transient or sub-adult male at least for a time. A male tiger keeps a large territory in order to include the home ranges of several females within its bounds, so that he may maintain mating rights with them. Spacing among females is less complete. Typically there is partial overlap with neighbouring female residents. They tend to have core areas, which are more exclusive, at least for most of the time. Home ranges of both males and females are not stable. The shift or alteration of a home range by one animal is correlated with a shift of another. Shifts from less suitable habitat to better ones are made by animals that are already resident. New animals become residents only as vacancies occur when a former resident moves out or dies. There are more places for resident females than for resident males.[13]

During seven years of camera trapping, tracking, and observational data in Chitwan National Park, 6 to 9 breeding tigers, 2 to 16 non-breeding tigers, and 6 to 20 young tigers of less than one year of age were detected in the study area of 100 km2 (39 sq mi). One of the resident females left her territory to one of her female offspring and took over an adjoining area by displacing another female; and a displaced female managed to re-establish herself in a neighboring territory made vacant by the death of the resident. Of 11 resident females, 7 were still alive at the end of the study period, 2 disappeared after losing their territories to rivals, and 2 died. The initial loss of two resident males and subsequent take over of their home ranges by new males caused social instability for two years. Of 4 resident males, 1 was still alive and 3 were displaced by rivals. Five litters of cubs were killed by infanticide, 2 litters died because they were too young to fend for themselves when their mothers died. One juvenile tiger was presumed dead after being photographed with severe injuries from a deer snare. The remaining young lived long enough to reach dispersal age, 2 of them becoming residents in the study area.[40]

Hunting and diet [edit]

Tigers are carnivores. They prefer hunting large ungulates such as chital, sambar, gaur, and to a lesser extent also barasingha, water buffalo, nilgai, serow and takin. Among the medium-sized prey species they frequently kill wild boar, and occasionally hog deer, muntjac and Gray langur. Small prey species such as porcupines, hares and peafowl form a very small part in their diet. Due to the encroachment of humans into their habitat, they also prey on domestic livestock.[41][42][43][44][45]

In most cases, tigers approach their victim from the side or behind from as close a distance as possible and grasp the prey's throat to kill it. Then they drag the carcass into cover, occasionally over several hundred meters, to consume it. The nature of the tiger's hunting method and prey availability results in a "feast or famine" feeding style: they often consume 18–40 kilograms (40–88 lb) of meat at one time.[9]

Bengal tigers have been known to take other predators, such as leopards, wolves, jackals, foxes, crocodiles, Asiatic black bears, sloth bears, and dholes as prey, although these predators are not typically a part of their diet. Adult elephants and rhinoceroses are too large to be successfully tackled by tigers, but such extraordinarily rare events have been recorded. The Indian hunter and naturalist Jim Corbett described an incident in which two tigers fought and killed a large bull elephant. If injured, old or weak, or their normal prey is becoming scarce, they may even attack humans and become man-eaters.[46]

Reproduction and lifecycle [edit]

The tiger in India has no definite mating and birth seasons. Most young are born in December and April.[47] Young have also been found in March, May, October and November.[48] In the 1960s, certain aspects of tiger behaviour at Kanha National Park indicated that the peak of sexual activity was from November to about February, with some mating probably occurring throughout the year.[49]

Royal Bengal Tiger's large piercing canine teeth

Males reach maturity at 4–5 years of age, and females at 3–4 years. A tigress comes into heat at intervals of about 3–9 weeks, and is receptive for 3–6 days. After a gestation period of 104–106 days, 1–4 cubs are born in a shelter situated in tall grass, thick bush or in caves. Newborn cubs weigh 780 to 1,600 g (1.7 to 3.5 lb) and they have a thick wooly fur that is shed after 3.5–5 months. Their eyes and ears are closed. Their milk teeth start to erupt at about 2–3 weeks after birth, and are slowly replaced by permanent dentition from 8.5–9.5 weeks of age onwards. They suckle for 3–6 months, and begin to eat small amounts of solid food at about 2 months of age. At this time, they follow their mother on her hunting expeditions and begin to take part in hunting at 5–6 months of age. At the age of 2–3 years, they slowly start to separate from the family group and become transient — looking out for an area, where they can establish their own territory. Young males move further away from their mother's territory than young females. Once the family group has split, the mother comes into heat again.[9]

Threats [edit]

Over the past century tiger numbers have fallen dramatically, with a decreasing population trend. None of the Tiger Conservation Landscapes within the Bengal tiger range is large enough to support an effective population size of 250 individuals. Habitat losses and the extremely large-scale incidences of poaching are serious threats to the species' survival.[1]

The challenge in the Western Ghats forest complex in western South India, an area of 14,400 square miles (37,000 km2) stretching across several protected areas is that people literally live on top of the wildlife. The Save the Tiger Fund Council estimates that 7,500 landless people live illegally inside the boundaries of the 386-square-mile (1,000 km2) Nagarhole National Park in southwestern India. A voluntary if controversial resettlement is underway with the aid of the Karnataka Tiger Conservation Project led by K. Ullas Karanth of the Wildlife Conservation Society.[citation needed]

A 2007 report by UNESCO, "Case Studies on Climate Change and World Heritage" has stated that an anthropogenic 45-cm rise in sea level, likely by the end of the 21st century, according to the Intergovernmental Panel on Climate Change, combined with other forms of anthropogenic stress on the Sundarbans, could lead to the destruction of 75% of the Sundarbans mangroves.[citation needed] The Forest Rights Act passed by the Indian government in 2006 grants some of India's most impoverished communities the right to own and live in the forests, which likely brings them into conflict with wildlife and under-resourced, under-trained, ill-equipped forest department staff. In the past, evidence showed that humans and tigers cannot co-exist.[50]

Poaching [edit]

The most significant immediate threat to the existence of wild tiger populations is the illegal trade in poached skins and body parts between India, Nepal and China. The governments of these countries have failed to implement adequate enforcement response, and wildlife crime remained a low priority in terms of political commitment and investment for years. There are well-organised gangs of professional poachers, who move from place to place and set up camp in vulnerable areas. Skins are rough-cured in the field and handed over to dealers, who send them for further treatment to Indian tanning centres. Buyers choose the skins from dealers or tanneries and smuggle them through a complex interlinking network to markets outside India, mainly in China. Other factors contributing to their loss are urbanization and revenge killing. Farmers blame tigers for killing cattle and shoot them. Their skins and body parts may however become a part of the illegal trade.[51]

The illicit demand for bones and body parts from wild tigers for use in Traditional Chinese medicine is the reason for the unrelenting poaching pressure on tigers on the Indian subcontinent. For at least a thousand years, tiger bones have been an ingredient in traditional medicines that are prescribed as a muscle strengthener and treatment for rheumatism and body pain.[52]

Between 1994 and 2009, the Wildlife Protection Society of India has documented 893 cases of tigers killed in India, which is just a fraction of the actual poaching and trade in tiger parts during those years.[53]

In 2006, India's Sariska Tiger Reserve lost all of its 26 tigers, mostly to poaching.[54] In 2007, police in Allahabad raided a meeting of suspected poachers, traders and couriers. One of the arrested persons was the biggest buyer of tiger parts in India who used to sell them off to the Chinese traditional medicinal market, using women from a nomadic tribe as couriers.[55] In 2009, none of the 24 tigers residing in the Panna Tiger Reserve were left due to excessive poaching.[56] In November 2011, two tigers were found dead in Maharashtra: a male tiger was trapped and killed in a wire snare; a tigress died of electrocution after chewing at an electric cable supplying power to a water pump; another tigress was found dead in Kanha Tiger Reserve landscape — poisoning is suspected to be the cause of her death.[57]

Human-tiger conflict [edit]

The Indian subcontinent has served as a stage for intense human and tiger confrontations. The region affording habitat where tigers have achieved their highest densities is also one which has housed one of the most concentrated and rapidly expanding human populations. At the beginning of the 19th century tigers were so numerous it seemed to be a question as to whether man or tiger would survive. It became the official policy to encourage the killing of tigers as rapidly as possible, rewards being paid for their destruction in many localities. The United Provinces supported large numbers of tigers in the submontane Terai region, where man-eating had been uncommon. In the latter half of the 19th century, marauding tigers began to take a toll of human life. These animals were pushed into marginal habitat, where tigers had formerly not been known, or where they existed only in very low density, by an expanding population of more vigorous animals that occupied the prime habitat in the lowlands, where there was high prey density and good habitat for reproduction. The dispersers had no where else to go, since the prime habitat was bordered in the south by cultivation. They are thought to have followed back the herds of domestic livestock that wintered in the plains when they returned to the hills in the spring, and then being left without prey when the herds dispersed back to their respective villages. These tigers were the old, the young and the disabled. All suffered from some disability, mainly caused either by gunshot wounds or porcupine quills.[58]

In the Sundarbans, 10 out of 13 man-eaters recorded in the 1970s were males, and they accounted for 86% of the victims. These man-eaters have been grouped into the confirmed or dedicated ones who go hunting especially for human prey; and the opportunistic ones, who do not search for humans but will, if they encounter a man, attack, kill and devour him. In areas where opportunistic man-eaters were found, the killing of humans was correlated with their availability, most victims being claimed during the honey gathering season.[59] Tigers in the Sunderbans presumably attacked humans who entered their territories in search of wood, honey or fish, thus causing them to defend their territories. The number of tiger attacks on humans may be higher outside suitable areas for tigers, where numerous humans are present but which contain little wild prey for tigers.[60] Between 1999 and 2001, the highest concentration of tigers attacks on people occurred in the northern and western boundaries of the Bangladesh Sundarbans. Most people were attacked in the mornings while collecting fuel wood, timber, or other raw materials, or while fishing.[61]

In Nepal, the incidence of man-eating tigers has been only sporadic. In Chitwan National Park no cases have been recorded prior to 1980. In the following few years, 13 persons have been killed and eaten in the park and its environs. In the majority of cases, man-eating appeared to have been related to an intra-specific competition among male tigers.[58]

In December 2012, a tiger was shot by the Kerala Forest Department on a coffee plantation on the fringes of the Wayanad Wildlife Sanctuary. Chief Wildlife Warden of Kerala ordered the hunt for the animal after mass protests erupted as the tiger had been carrying away livestock. The Forest Department had constituted a special task force to capture the animal with the assistance of a 10-member Special Tiger Protection Force and two trained elephants from the Bandipur Tiger Reserve in Karnataka.[62][63]

Conservation efforts [edit]

A Bengal tiger captured in Karnataka, India.

An area of special interest lies in the Terai Arc Landscape in the Himalayan foothills of northern India and southern Nepal, where 11 protected areas comprising dry forest foothills and tall-grass savannas harbor tigers in a 49,000 square kilometres (19,000 sq mi) landscape. The goals are to manage tigers as a single metapopulation, the dispersal of which between core refuges can help maintain genetic, demographic, and ecological integrity, and to ensure that species and habitat conservation becomes mainstreamed into the rural development agenda. In Nepal a community-based tourism model has been developed with a strong emphasis on sharing benefits with local people and on the regeneration of degraded forests. The approach has been successful in reducing poaching, restoring habitats, and creating a local constituency for conservation.[64]

WWF partnered with Leonardo DiCaprio to form a global campaign, Save Tigers Now, with the ambitious goal of building political, financial and public support to double the wild tiger population by 2022.[65] Save Tigers Now started its campaign in 12 different WWF Tiger priority landscapes, since May 2010.[66]

In India [edit]

A Bengal tiger roams around in Ranthambore National Park, Rajasthan, India.

In 1972, Project Tiger was launched aiming at ensuring a viable population of tigers in the country and preserving areas of biological importance as a natural heritage for the people. The project's task force visualised these tiger reserves as breeding nuclei, from which surplus animals would emigrate to adjacent forests. The selection of areas for the reserves represented as close as possible the diversity of ecosystems across the tiger's distribution in the country. Funds and commitment were mustered to support the intensive program of habitat protection and rehabilitation under the project. By the late 1980s, the initial nine reserves covering an area of 9,115 square kilometres (3,519 sq mi) had been increased to 15 reserves covering an area of 24,700 square kilometres (9,500 sq mi). More than 1100 tigers were estimated to inhabit the reserves by 1984.[67]

Through this initiative the population decline was reversed initially, but has resumed in recent years; India's tiger population decreased from 3,642 in the 1990s to just over 1,400 from 2002 to 2008.[68]

The Indian Wildlife Protection Act of 1972 enables government agencies to take strict measures so as to ensure the conservation of the Bengal tigers. The Wildlife Institute of India estimates showed that tiger numbers had fallen in Madhya Pradesh by 61%, Maharashtra by 57%, and Rajasthan by 40%. The government's first tiger census, conducted under the Project Tiger initiative begun in 1973, counted 1,827 tigers in the country that year. Using that methodology, the government observed a steady population increase, reaching 3,700 tigers in 2002. However, the use of more reliable and independent censusing technology (including camera traps) for the 2007–2008 all-India census has shown that the numbers were in fact less than half than originally claimed by the Forest Department.[69]

Following the revelation that only 1,411 Bengal tigers exist in the wild in India, down from 3,600 in 2003, the Indian government has decided to set up eight new tiger reserves.[70] Because of dwindling tiger numbers, the Indian government has pledged US$153 million to further fund the Project Tiger initiative, set-up a Tiger Protection Force to combat poachers, and fund the relocation of up to 200,000 villagers to minimize human-tiger interaction.[71]

Tiger scientists in India, such as Raghu Chundawat and Ullas Karanth, have faced criticism from the forest department. Both these scientists have been for years calling for use of technology in the conservation efforts. Chundawat, in the past, had been involved with radio telemetry (collaring the tigers). While studying tigers in Panna tiger reserve, he repeatedly warned the FD authorities about the problem of tiger poaching in the reserve; they remained in denial, producing bogus numbers of tigers in their reports, and banned Chundawat from the reserve. Eventually, however, it was proven he was right, as in 2008. the authorities admitted that all tigers in Panna have been poached.[72] Karanth has been instrumental in using camera traps, radiotelemetry and prey counts. During the 1990s and early 2000s he also noticed that tiger numbers were significantly lower than the official figures; his insistence on using modern science in tiger conservation and uncompromising efforts to save tigers and their habitat have earned him many enemies.

The project to map all the forest reserves in India has not been completed yet, though the Ministry of Environment and Forests had sanctioned Rs. 13 million for the same in March 2004.

George Schaller wrote:[73]

"India has to decide whether it wants to keep the tiger or not. It has to decide if it is worthwhile to keep its National Symbol, its icon, representing wildlife. It has to decide if it wants to keep its natural heritage for future generations, a heritage more important than the cultural one, whether we speak of its temples, the Taj Mahal, or others, because once destroyed it cannot be replaced."

In January 2008, the Government of India launched a dedicated anti-poaching force composed of experts from Indian police, forest officials and various other environmental agencies.[74] Indian officials successfully started a project to reintroduce the tigers into the Sariska reserve.[75] The Ranthambore National Park is often cited as a major success by Indian officials against poaching.[76]

In Bangladesh [edit]

WildTeam [1] is working with local communities and the Bangladesh Forest Department to reduce human-tiger conflict in the Bangladesh Sundarbans. For over 100 years people, tigers, and livestock have been injured and killed in the conflict; in recent decades up to 50 people, 80 livestock, and 3 tigers have been killed in a year. Now, through WildTeam's work, there is a boat-based Tiger Response team that provides first aid, transport, and body retrieval support for people being killed in the forest by tigers. WildTeam has also set up 49 volunteer Village Response Teams that are trained to save tigers that have strayed into the village areas and would be otherwise killed. These village teams are made up of over 350 volunteers, who are also now supporting anti-poaching work and conservation education/awareness activities. WildTeam also works to empower local communities to access the government funds for compensating the loss/injury of livestock and people from the conflict. To monitor the conflict and assess the effectiveness of actions, WildTeam have also set up a human-tiger conflict data collection and reporting system.

In Nepal [edit]

The government aims at doubling the country's tiger population by 2022, and in May 2010, decided to establish Banke National Park with a protected area of 550 square kilometres (210 sq mi), which bears good potential for tiger habitat.[77]

Ex situ [edit]

Bengal tigers have been captive bred since 1880 and widely crossed with other tiger subspecies.[78] Indian zoos have bred tigers for the first time being at the Alipore Zoo in Kolkata. The 1997 International Tiger Studbook lists the global captive population of Bengal tigers at 210 individuals that are all kept in Indian zoos, except for one female in North America. Completion of the Indian Bengal Tiger Studbook is a necessary prerequisite to establishing a captive management program for tigers in India.[79]

Admixed genetic heritage [edit]

In the late 1990s, microsatellite analysis was used to identify hybrids of Indian and Siberian tigers through polymerase chain reaction amplification of hair samples. The study revealed that two tigers of the wild population of Dudhwa National Park had alleles contributed by both subspecies.[80] Both tigers had an Indian tiger mitochondrial haplotype indicating that these animals had an Indian tiger mother.[81]

In July 1976, Billy Arjan Singh acquired a hand-reared tigress from Twycross Zoo in the United Kingdom, and reintroduced her to the wild in Dudhwa National Park with the permission of India's then-Prime Minister Indira Gandhi.[82] In the 1990s, some tigers from this area were observed to have the typical appearance of Siberian tigers: white complexion, pale fur, large head and wide stripes. It was later proved that the tigress was a hybrid Siberian-Bengal tigress. Dudhwa tigers constitute about 1% of India's total wild population, but the possibility exists of this admixed genetic heritage being passed on to other tiger populations and jeopardizing the Bengal tiger as a distinct subspecies.[83][84][85][86]

"Re-wilding" project in South Africa [edit]

In 2000, the Bengal tiger re-wilding project Tiger Canyons was started by John Varty, who together with the zoologist Dave Salmoni trained captive-bred tiger cubs how to stalk, hunt, associate hunting with food and regain their predatory instincts. They claimed that once the tigers proved that they can sustain themselves in the wild, they would be released into a free-range sanctuary of South-Africa to fend for themselves.[87]

The project has received controversy after accusations by their investors and conservationists of manipulating the behaviour of the tigers for the purpose of a film production, Living with Tigers, with the tigers believed to be unable to hunt.[88][89] Stuart Bray, who had originally invested a large sum of money in the project, claimed that he and his wife, Li Quan, watched the film crew "[chase] the prey up against the fence and into the path of the tigers just for the sake of dramatic footage."[88][89]

The four tigers involved in this project have been confirmed to be crossbred Siberian–Bengal tigers, which should neither be used for breeding nor being released into the Karoo, which for them is unsuitable habitat.[90] Tigers that are not genetically pure will not be able to participate in the tiger Species Survival Plan, as they are not used for breeding, and are not allowed to be released into the wild.[91]

In the USA [edit]

In October 2011, 18 Bengal tigers were among the exotic animals shot by the local sheriff's department after the 2011 Ohio exotic animal release.[92]

In culture [edit]

An early silver coin of Uttama Chola found in Sri Lanka showing the tiger emblem of the Cholas.[93][94]
The Shiva Pashupati seal with tiger to right of the seated Shiva figure Pashupati

The tiger is one of the animals displayed on the Pashupati seal of the Indus Valley Civilisation. The tiger crest is the emblem on the Chola coins. The seals of several Chola copper coins show the tiger, the Pandya emblem fish and the Chera emblem bow, indicating that the Cholas had achieved political supremacy over the latter two dynasties. Gold coins found in Kavilayadavalli in the Nellore district of Andra Pradesh have motifs of the tiger, bow and some indistinct marks.[95]

Today, the tiger is the national animal of India. Bangladesh has the image of the tiger on banknotes. The political party Muslim League of Pakistan has the tiger as its election symbol.[96]

References [edit]

  1. ^ a b c Chundawat, R. S., Khan, J. A., Mallon, D. P. (2011). "Panthera tigris tigris". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. 
  2. ^ Jhala, Y. V., Qureshi, Q., Sinha, P. R. (Eds.) (2011). Status of tigers, co-predators and prey in India, 2010. National Tiger Conservation Authority, Govt. of India, New Delhi, and Wildlife Institute of India, Dehradun. TR 2011/003 pp-302
  3. ^ a b Global Tiger Initiative. (2011). Global Tiger Recovery Program 2010–2022. Global Tiger Initiative Secretariat, Washington.
  4. ^ a b The Economic Times (2010). Nepal has 155 adult tigers, 5% of world population. Times Internet Limited
  5. ^ a b Sangay, T., Wangchuk, T. (2005). Tiger Action Plan for Bhutan 2006–2015. Nature Conservation Division, Department of Forests, Ministry of Agriculture, Royal Government of Bhutan and WWF Bhutan Programme, Thimphu.
  6. ^ a b Pocock, R. I. (1929). "Tigers". Journal of the Bombay Natural History Society 33: 505–541. 
  7. ^ Pocock, R. I. (1939). Panthera tigris, pp. 197–210 in The Fauna of British India, Including Ceylon and Burma. Mammalia: Volume 1. Taylor and Francis, Ltd., London.
  8. ^ Gupta, O. (2006). Encyclopaedia of India, Pakistan and Bangladesh. Delhi: Gyan Publishing. p. 313. ISBN 8182053897. 
  9. ^ a b c Mazák, V (1981). "Panthera tigris". Mammalian Species 152 (152): 1–8. doi:10.2307/3504004. 
  10. ^ Karanth, K. U. (2003). "Tiger ecology and conservation in the Indian subcontinent". Journal of the Bombay Natural History Society 100 (2–3): 169–189. 
  11. ^ Slaght, J. C., D. G. Miquelle, I. G. Nikolaev, J. M. Goodrich, E. N. Smirnov, K. Traylor-Holzer, S. Christie, T. Arjanova, J. L. D. Smith, Karanth, K. U. (2005). Chapter 6. Who‘s king of the beasts? Historical and recent body weights of wild and captive Amur tigers, with comparisons to other subspecies, pp. 25–35 in: Miquelle, D.G., Smirnov, E.N., Goodrich, J.M. (Eds.) Tigers in Sikhote-Alin Zapovednik: Ecology and Conservation. PSP, Vladivostok, Russia (in Russian)
  12. ^ a b Barlow, A.; Mazák, J., Ahmad, I. U., Smith, J. L.D. (2010). "A preliminary investigation of Sundarbans tiger morphology". Mammalia 74 (3): 329–331. doi:10.1515/mamm.2010.040. 
  13. ^ a b c McDougal, C. (1977). The Face of the Tiger. Rivington Books and André Deutsch, London.
  14. ^ Sterndale, R. A. (1884) Felis Tigris. No. 201 in: Natural History of the Mammalia of India and Ceylon. Thacker, Spink and Co., Calcutta.
  15. ^ Brander, A. (1923) Wild Animals in Central India. Edwin Arnold & Co., London.
  16. ^ Hewett, J. P., Hewett Atkinson, L. (1938). Jungle trails in northern India: reminiscences of hunting in India. Metheun and company limited, London.
  17. ^ Wood, G. 1983. The Guinness book of animal facts and feats. Sterling Pub. Co. Inc., 3rd ed., ISBN 978-0-85112-235-9
  18. ^ Dinerstein, E. (2003). Return of the Unicorns. Columbia University Press. ISBN 0-231-08450-1
  19. ^ Kitchener, A.C., Dugmore, A. J. (2000). "Biogeographical change in the tiger, Panthera tigris". Animal Conservation 3 (2): 113–124. doi:10.1111/j.1469-1795.2000.tb00236.x. 
  20. ^ Luo, S. J. et al. (2004). "Phylogeography and Genetic Ancestry of Tigers (Panthera tigris)". PLoS Biology 2 (12): e442. doi:10.1371/journal.pbio.0020442. PMC 534810. PMID 15583716. 
  21. ^ Manamendra-Arachchi, K., Pethiyagoda, R., Dissanayake, R., Meegaskumbura, M. (2005). "A Second Extinct Big Cat From The Late Quaternary of Sri Lanka". The Raffles Bulletin of Zoology 2005 (Supplement No. 12): 423–434. 
  22. ^ a b c Wikramanayake, E.D., Dinerstein, E., Robinson, J.G., Karanth, K.U., Rabinowitz, A., Olson, D., Mathew, T., Hedao, P., Connor, M., Hemley, G., Bolze, D. (1999) Where can tigers live in the future? A framework for identifying high-priority areas for the conservation of tigers in the wild, pp. 255–272 in: Seidensticker, J., Christie, S., Jackson, P. (eds.) Riding the Tiger. Tiger Conservation in human-dominated landscapes. Cambridge University Press, Cambridge. hardback ISBN 0-521-64057-1, paperback ISBN 0-521-64835-1.
  23. ^ Karanth, K. U., Nichols, J. D., Seidensticker, J., Dinerstein, E., Smith, J. L. D., McDougal, C., Johnsingh, A. J. T., Chundawat, R. S., Thapar, V. (2003). Science deficiency in conservation practice: the monitoring of tiger populations in India. Animal Conservation (2003) 6: 141–146.
  24. ^ Jhala, Y. V., Gopal, R., Qureshi, Q. (eds.) (2008), Status of the Tigers, Co-predators, and Prey in India, TR 08/001, National Tiger Conservation Authority, Govt. of India, New Delhi; Wildlife Institute of India, Dehradun 
  25. ^ Joy over India tiger cubs births BBC News, 6 May 2008.
  26. ^ Rahman, M. (2008). Tiger reintroduced at Indian reserve after poachers kill off population. Guardian News and Media Limited.
  27. ^ a b Khan, M. M. H. (2004). Ecology and conservation of the Bengal tiger in the Sundarbans Mangrove forest of Bangladesh. PhD thesis, University of Cambridge.
  28. ^ Sanderson, E., J. Forrest, C. Loucks, J. Ginsberg, E. Dinerstein, J. Seidensticker, P., Leimgruber, M., Songer, A. Heydlauff, T. O’Brien, G. Bryja, S. Klenzendorf, and E. Wikramanayake (2006). Setting priorities for the conservation and recovery of wild tigers: 2005–2015. The technical assessment. WCS, WWF, Smithsonian, and NFWF-STF, New York – Washington, D.C.
  29. ^ Ministry of Environment and Forests. (2004). Report on Sundarbans Tiger Census. Ministry of Environment and Forests, Bangladesh.
  30. ^ Khan, M. (2012). "Population and prey of the Bengal Tiger Panthera tigris tigris (Linnaeus, 1758) (Carnivora: Felidae) in the Sundarbans, Bangladesh". Journal of Threatened Taxa 4: 2370–2380. 
  31. ^ Barlow, A.; Smith, J. L. D., Ahmad, I. U., Hossain, A. N., Rahman, M. and Howlader, A. (2011). "Female tiger Panthera tigris home range size in the Bangladesh Sundarbans: the value of this mangrove ecosystem for the species' conservation". Oryx 45: 125–128. doi:10.1017/S0030605310001456. 
  32. ^ Barlow, A. (2009). The Sundarbans tiger: Adaptation, population, and conflict management. University of Minnesota. 
  33. ^ Barlow, A.; Ahmed, M. I. U., Rahman, M. M., Howlader, A., Smith, A. C. and Smith, J. L. D. (2008). "Linking monitoring and intervention for improved management of tigers in the Sundarbans of Bangladesh". Biological Conservation 14 (8): 2032–2040. doi:10.1016/j.biocon.2008.05.018. 
  34. ^ Smith, J. L. D., Ahern, S. C., McDougal, C. (1998). "Landscape Analysis of Tiger Distribution and Habitat Quality in Nepal". Conservation Biology 12 (6): 1338–1346. doi:10.1046/j.1523-1739.1998.97068.x. 
  35. ^ Anonymous (2009). "Estimate of 121 breeding tigers in Nepal". Cat News 51: 49–50. 
  36. ^ WWF Nepal (2010) More tigers found in Nepal as Nepal-India trans-boundary efforts for tiger conservation intensify. WWF News, 2 August 2010.
  37. ^ Dorji, D. P., Santiapillai, C. (1989). "The Status, Distribution and Conservation of the Tiger Panthera tigris in Bhutan". Biological Conservation 48 (4): 311–319. doi:10.1016/0006-3207(89)90105-5. 
  38. ^ Walker, M. (20 September 2010) Lost tiger population discovered in Bhutan mountains. BBC Earth News.
  39. ^ Chundawat, T. S., Gogate, N. Johnsingh, A. J. T. (1999) Tigers in Panna: preliminary results from an Indian tropical dry forest, pp. 123–129 in: Seidensticker, J., Christie, S., Jackson, P. (eds.) Riding the Tiger. Tiger Conservation in human-dominated landscapes. Cambridge University Press, Cambridge. hardback ISBN 0-521-64057-1, paperback ISBN 0-521-64835-1.
  40. ^ Barlow, A. C. D., McDougal, C., Smith, J. L. D., Gurung, B., Bhatta, S. R., Kumal, S., Mahato, B.. Tamang, D. B. (2009). "Temporal Variation in Tiger (Panthera tigris) Populations and Its Implications for Monitoring". Journal of Mammalogy 90 (2): 472–478. doi:10.1644/07-MAMM-A-415.1. 
  41. ^ Bagchi, S., Goyal, S. P., Sankar, K. (2003). "Prey abundance and prey selection by tigers (Panthera tigris) in a semi-arid, dry deciduous forest in western India". Journal of Zoology 260 (3): 285–290. doi:10.1017/S0952836903003765. 
  42. ^ Andheria, A. P., Karanth, K. U., Kumar, N. S. (2007). "Diet and prey profiles of three sympatric large carnivores in Bandipur Tiger Reserve, India". Journal of Zoology 273 (2): 169–175. doi:10.1111/j.1469-7998.2007.00310.x. 
  43. ^ Biswas, S., Sankar, K. (2002). "Prey abundance and food habit of tigers (Panthera tigris tigris) in Pench National Park, Madhya Pradesh, India". Journal of Zoology 256 (3): 411–420. doi:10.1017/S0952836902000456. 
  44. ^ Wegge, P., Odden, M., Pokharel, C. Pd., Storaasc, T. (2009). "Predator–prey relationships and responses of ungulates and their predators to the establishment of protected areas: A case study of tigers, leopards and their prey in Bardia National Park, Nepal". Biological Conservation 142: 189–202. doi:10.1016/j.biocon.2008.10.020. 
  45. ^ Prachi, M., Kulkarni, J. (2006) Monitoring of Tiger and Prey Population Dynamics in Melghat Tiger Reserve, Maharashtra, India. Final Technical Report. Envirosearch, Pune.
  46. ^ Mazak, V. (1996) Der Tiger : Panthera tigris. Westarp Wissenschaften, Magdeburg, Heidelberg, Berlin, Oxford ISBN 3-89432-759-6.
  47. ^ Brander, A. A. D. (1923) Wild Animals in Central India. Edwin Arnold & Co., London.
  48. ^ Sanderson, G. P. (1912) Thirteen years among the wild beasts of India: their haunts and habits from personal observations; with an account of the modes of capturing and taming elephants. John Grant, Edinburgh.
  49. ^ Schaller, G. (1967) The Deer and the Tiger: A Study of Wildlife in India. Chicago Press, Chicago.
  50. ^ Buncombe, A. (31 October 2007) The face of a doomed species. The Independent.
  51. ^ Banks, D., Lawson, S., Wright, B. (eds.) (2006) Skinning the Cat: Crime and Politics of the Big Cat Skin Trade. Environmental Investigation Agency, Wildlife Protection Society of India
  52. ^ Hemley, G., Mills, J. A. (1999) "The beginning of the end of tigers in trade?" in: Seidensticker, J., Christie, S., Jackson, P. (eds.) Riding the Tiger. Tiger Conservation in human-dominated landscapes. Cambridge University Press, Cambridge. hardback ISBN 0-521-64057-1, paperback ISBN 0-521-64835-1
  53. ^ Wildlife Protection Society of India (2009) WPSI's Tiger Poaching Statistics.
  54. ^ Bhaskarang, G. (19 June 2009) Poachers driving Indian tigers into oblivion. The Japan Times Online.
  55. ^ Banerjee, B. (2007). Tiger Poaching Ring Busted by Indian Police. National Geographic Society News, 6 December 2007.
  56. ^ Ali, F. M. (2009). Indian tiger park has no tigers. BBC News 14 July 2009.
  57. ^ Wildlife Watch Group. (2011). Central India Loses Four Tigers, including the Legendary B2. Wildlife Times 20: 9.
  58. ^ a b McDougal, C. (1987) "The man-eating tigers in geographical historical perspective", in: Tilson, R. L., Seal, U.S. (eds.) Tigers of the World. Noyes Publications, New Jersey. pp. 435–448, ISBN 0815511337.
  59. ^ Hendrichs, H. (1975). "The status of the tiger (Panthera tigris) in the Sundarbans Mangrove". Säugetierkundliche Mitteilungen 23: 161–199. 
  60. ^ Jackson, P. (1985). "Man-eaters". International Wildlife 15: 4–11. 
  61. ^ Azad, M. A. K., Hashem, M. A., Hossain, M. M. (2005). "Study on Human Royal Bengal Tiger Interaction of in situ and ex situ in Bangladesh". Journal of Biological Sciences 5 (3): 250–252. doi:10.3923/jbs.2005.250.252. 
  62. ^ Straying tiger meets with a bloody end, The Hindu, 3 December 2012.
  63. ^ Manoj, E. M. (3 December 2012) Tiger gone, but tension simmers, The Hindu.
  64. ^ Damania, R., Seidensticker, J., Whitten, T., Sethi, G., Mackinnon, K., Kiss, A., Kushlin, A. (2008) A Future for Wild Tigers. World Bank, Washington, D.C.
  65. ^ "WWF and leonardo partner to protect Tiger Habitat through Save Tigers Now". SaveTigersNow.org. Retrieved 30 October 2012. 
  66. ^ "Global Tiger Conservation initiative kick started Conservation Campaign in 2010". World Wild Fund. Retrieved 30 October 2012. 
  67. ^ Panwar, H. S. (1987) Project Tiger: The reserves, the tigers, and their future. In: Tilson, R. L., Seal, U. S., Minnesota Zoological Garden, IUCN/SSC Captive Breeding Group, IUCN/SSC Cat Specialist Group. Tigers of the world: the biology, biopolitics, management, and conservation of an endangered species. Noyes Publications, Park Ridge, N.J., pp. 110–117, ISBN 0815511337.
  68. ^ Ramesh, R. (13 February 2008) Indian wild tiger numbers almost halve. Guardian News and Media Limited.
  69. ^ Sethi, N. (13 February 2008). "Just 1,411 tigers in India". The Times of India. Retrieved 3 March 2009. 
  70. ^ Sharma, A. (13 February 2008) article India Reports Sharp Decline in Wild Tigers. National Geographic News.
  71. ^ Page, Jeremy (5 July 2008). "Tigers flown by helicopter to Sariska reserve to lift numbers in western India". The Times (London). Retrieved 26 April 2010. 
  72. ^ "The great Panna cover-up". NDTV. 29 April 2010. Retrieved 29 April 2009. 
  73. ^ Shashwat, D.C. (27 June 2007) "The Last Roar?", Dataquest Magazine, India.
  74. ^ "India launches anti-poaching force to curb tiger, wildlife trade". The Earth Times. 23 January 2008. 
  75. ^ "It's the tale of a tiger, two tigresses in wilds of Sariska". The Economic Times. 2 March 2009. 
  76. ^ Sebastian, Sunny (11 March 2009). "Tigers galore in Ranthambhore National Park". The Hindu. 
  77. ^ Bhushal, R. P. (13 May 2010) Nod to Banke National Park. The Himalayan Times.
  78. ^ Luo, S., Johnson, W. E., Martenson, J., Antunes, A., Martelli, P., Uphyrkina, O., Traylor-Holzer, K., Smith, J. L.D., O’Brien, S. J. (2008). "Subspecies Genetic Assignments of Worldwide Captive Tigers Increase Conservation Value of Captive Populations". Current Biology 18 (8): 592–596. doi:10.1016/j.cub.2008.03.053. PMID 18424146. 
  79. ^ Bengal Tiger. The Save The Tiger Fund
  80. ^ Shankaranarayanan, P., Banerjee, M., Kacker, R. K., Aggarwal, R. K. and Singh, L. (1997). "Genetic variation in Asiatic lions and Indian tigers". Electrophoresis 18 (9): 1693–1700. doi:10.1002/elps.1150180938. PMID 9378147. 
  81. ^ Shankaranarayanan, P., Singh, L. (1998). "Mitochondrial DNA sequence divergence among big cats and their hybrids". Current Science 75 (9): 919–923. 
  82. ^ Singh, A. (1981) Tara, a tigress. Quartet Books, London and New York, ISBN 070432282X.
  83. ^ Menon, S. (17 November 1997) Tainted Royalty. India Today.
  84. ^ Bagla, P. (19 November 1998) Indian tiger isn't 100 per cent "swadeshi". The Indian Express.
  85. ^ Tiger Territory The Tale of Tara, 4: Tara's Heritage
  86. ^ Tiger Territory Genetic pollution in wild Bengal tigers
  87. ^ Discovery Channel, A. (2001). "Meet the Tiger Men: John Varty". Discovery Channel. 
  88. ^ a b "Discovery Film Proclaimed A Fraud; Broadcaster to be Sued". Wildlife Film News 56. February 2004. Retrieved 27 August 2011. 
  89. ^ Maxine, A. (2001). "Releasing Tigers. Tiger Moon Sanctuary.". Tiger Territory. 
  90. ^ Arrick, A., Mckinney, K. (2007) Purrrfect Breed? TylerPaper.com, 13 August 2007
  91. ^ "Ohio animal Terry Thompson owner shot himself – police". BBC News. 20 October 2011. Retrieved 21 October 2011. "Among those killed were 17 lions and 18 Bengal tigers. US nature TV host Jack Hanna said the killing of the tigers was especially tragic as there were only about 1,400 remaining in the world." 
  92. ^ Nilakanta Sastri, K. A. (2003). A history of South India : from prehistoric times to the fall of Vijayanagar. 4th edition. Oxford University Press, New Delhi.
  93. ^ Chopra, P. N.; Ravindran, T. K., Subrahmanian, N. (2003). History of South India ; Ancient, Medieval and Modern. New Delhi: S. Chand & Company Ltd. p. 31. ISBN 81-219-0153-7. 
  94. ^ Singh, U. (2008). A History of Ancient and Early Medieval India: From the Stone Age to the 12th Century. Pearson Education, India.
  95. ^ Jackson, P. (1999). The tiger in human consciousness and its significance in crafting solutions for tiger conservation, pp. 50–54 in: Seidensticker, J., Christie, S., Jackson, P. (eds.) Riding the Tiger. Tiger Conservation in human-dominated landscapes. Cambridge University Press, Cambridge. hardback ISBN 0-521-64057-1, paperback ISBN 0-521-64835-1.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!