Overview

Brief Summary

Species Abstract

The Indus River dolphin (scientific name: Platanista minor) is freshwater cetacean closely related to the Ganges River dolphin (Platanista gangetica). These two endangered dolphins were long regarded as a single species and some regard them as two subspecies rather than distinct and separate species. Though Platanista minor and Platanista gangetica barely differ morphologically except for slight differences in tail lengths, the two species are distinguishable by their ranges. Platanista minor occurs only in the Indus River system, while Platanista gangetica inhabits only the Ganges River system.

The close connection of these species is likely explained by the fact that "until the late Pliocene, the present-day Indus, Ganges and Brahmaputra (except for the upper reach, the Yarlung Zangpo Jiang Rivers constituted a single westward-flowing river called the Indobrahm (Hora 1950, 1953). As Mohan and Dey note, even up until historical times there was probably sporadic faunal exchange between the Indus and Ganges drainages by way of head-stream capture on the low Indo-Gangetic plains, between the Sutlej (Indus) and Yamuna (Ganges) Rivers.
  • * Encyclopedia of Earth. Author: Encyclopedia of Life. Topic ed. C.Michael Hogan.. "Indus River dolphin". Ed.-in-chief Cutler J.Cleveland. National Council for Science and Environment. Washington DC eoearth.org/article/Indus_river_dolphin?topic=49540
  • * R.S.Lal.Mohan, S.C.Dey, S.P.Bairagi and S.Roy. 1997. "On a survey of the Ganges River dolphin Platanista minor in Brahmaputra River , Assam" . Journal of the Bombay Natural History Society. 94:484-495
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth; Encyclopedia of Life

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

River Indus Dolphins

Other names: Bhulan, Susu, Blind River Dolphin, Indus Susu

About: Indus dolphins are mammals, not fish. They come up to the surface for air, and as humans do, they give birth to live young, which feed on their mothers' milk. The Indus River dolphin is one of four river dolphin species and subspecies in the world that spend all their lives in freshwater. 

Habitat: Found in silt laden turbid water, the Indus River dolphin once inhabited nearly the entire lower Indus River system. Currently, however, it is confined to the range highlighted on the map.

Weight: The Indus River dolphin weighs 70-110 kg (155 - 245 lbs).

Length: The maximum size is 2.5m (8.2 ft), with males smaller than females.

Colour: Mid gray-brown.

Eyes: The dolphin is functionally blind and has no lens in its tiny eye.

Teeth: Adults have between 30 and 36 sharp teeth on each side of the rostrum. The teeth are very long, protruding at the end of the rostrum.

Rostrum: River dolphins possess a much longer snout (rostrum) than most oceanic dolphins, up to one fifth of their body length.

Breathe: Dolphins breathe through a blowhole located on the top of their heads.

Neck: The neck is narrow and relatively flexible, easing its movements in the complicated river environment.

Flippers: The dolphin has very broad flippers to help it stabilise at slow swimming speed.

Reproduction: The gestation period for the dolphins is approximately 10 months and it is believed that the babies are born in spring. When a baby is born it is about 70 cm long (almost the length of a domestic cat and the mother helps it to the surface to breathe. Babies stay close to their mother for the first six months of their life.

Life span: Scientists think that these dolphins can live for approximately 20 years.

Diet: The Indus River dolphin eats crustaceans such as prawns, as well as fish such as gobies, catfish and carp.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Hira Abro

Supplier: Hira Abro

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indus River dolphins, Platanista minor, are found only in the Indus River in Pakistan. Platanista minor used to range throughout the river system, but the dolphins are now only found in the waters above the Kotri Barrage and below the Chasma, Trimmu, Sidhnai, and Islam Barrages. These human-created barriers, in addition to changes in rainfall patterns, have greatly limited the dolphins’ distribution.

Biogeographic Regions: oriental (Native )

  • Hamilton, H., S. Caballers, A. Collins, R. Brownell. 2001. Evolution of river dolphins. Proc. R. Soc. Lond., 268: 549-558.
  • Mann, J., R. Connor, P. Tyack, H. Whitehead. 2000. Cetacean societies: field studies of whales and dolphins. Chicago: University of Chicago Press.
  • Moreno, P. 2004. Ganges and Indus dolphins (Platanistidae). Pp. 13-17 in M Hutchins, D Kleiman, V Geist, M McDade, eds. Grzimek's Animal Life Encyclopedia, Vol. Volume 15: Mammals IV, Second Edition Edition. Detroit: Thompson Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This subspecies is endemic to the rivers of the lower Indus basin in Pakistan. Historically it occurred in the Indus mainstem and the Sutlej, Beas, Ravi, Chenab, and Jhelum tributaries. It ranged from the Indus delta upstream to the Himalayan foothills where rocky barriers or shallow water prevented further upstream movement. Development of the vast Indus Basin Irrigation System has severely fragmented the dolphin population within a network of barrages (low, gated, diversion dams) and water diversion has dramatically reduced the extent of dolphin habitat. Current occupancy is effectively limited to three subpopulations in the Indus mainstem located between the Chashma and Taunsa, Taunsa and Guddu, and Guddu and Sukkur Barrages. A few individuals still remain above Chashma Barrage and below Sukkur Barrage (Braulik 2003, Reeves and Chaudhry 1998, Reeves 1998) (see Figure 1; follow link below).

The Indus River Dolphin was considered by some researchers as a distinct species for several decades (1970s–1990s) and was listed as such in the 1996 Red List. Its range is disjunct with that of the other subspecies, Ganges River Dolphin, Platanista gangetica gangetica, and therefore the two have been assessed and listed, and should be managed, separately.

The map shows where the species may occur. The species has not been recorded for all the states within the hypothetical range as shown on the map. States for which confirmed records of the species exist are included in the list of native range states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Pakistan (Indus R. and tributaries)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Indus River dolphins are roughly the same color as the river, gray or brown, though they sometimes are lighter on their undersides. Their “beaks” are distinctively swollen at the tip and very long, reaching 20% of the length of their bodies, with large, visible teeth. In contrast to their “beaks”, their dorsal fins are rather small and reduced compared to other river dolphins. Large flippers and flukes, combined with long and remarkably flexible necks, probably help the dolphins navigate effectively. Platanista minor has external ears located below their eyes, but their eyes are very small and probably can only see shadowy, unclear images. Though Platanista minor and Platanista gangetica barely differ physically except for slight differences in tail lengths, the two species are distinguishable by their ranges. Platanista minor lives only in the Indus River system, while Platanista gangetica only inhabits the Ganges River system. Females are larger than males.

Average mass: 84 kg.

Range length: 2 to 2.5 m.

Sexual Dimorphism: female larger

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Platanista minor currently exists only in the freshwater Indus River. However, some paleontologists believe that river dolphins might have evolved from marine-dwelling relatives that eventually moved to estuaries and then rivers as seawater levels rose and fell during the Miocene. Though this species prefers water deeper than 3 meters, Indus River dolphins have special adaptations such as swimming on their sides that enable them to exist in shallower waters as well. The temperature of the water ranges from 8-33 degrees C.

Range elevation: 0 to 250 m.

Range depth: 3 to 9 m.

Habitat Regions: freshwater

Aquatic Biomes: benthic ; rivers and streams; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Indus River Dolphins generally occur in the deepest river channel and are less common in secondary channels and small braids (Bhatti and Pilleri 1982, Braulik 2003). Reported habitat preferences include channel constrictions, confluences, and deep, low-velocity water (Kasuya and Nishiwaki 1975, Khan and Niazi 1989, Braulik 2004). During the low-water season (October to April), barrages divert almost all river water such that dolphin habitat downstream of Sukkur Barrage and in some tributary segments has been eliminated. As water levels drop in the winter, dolphins are concentrated in the remaining deep areas, including the head ponds upstream of barrages.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Indus River dolphins use their echolocation abilities combined with their highly toothed, long snouts to forage for many bottom-dwelling animals including fish and invertebrates. Platanista minor has been known to eat some species of catfish, herring, carp, gobies, mahseers, prawns, and clams. Captive individuals reportedly consume about a kilogram of food each day.

Animal Foods: fish; mollusks; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore , Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Indus River dolphins each eat about a kilogram of benthic fish and invertebrates daily, it is not clear how strongly they impact any of their prey populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Platanista minor has few if any natural predators, however, they are often hunted by local people.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Indus River dolphins have extremely poor eyesight, perhaps since vision is nearly useless to navigate the murky rivers in which they live. They instead rely on echolocation to perceive their environment. Indeed, one of the common names for Platanista minor is “blind river dolphin”. Their external ears might help receive echolocation signals, which are intermittent pulses rather than continuous whistles. Though Indus River dolphins are very vocal, they use sounds for communication only about 5% of the time that they vocalize.

Communication Channels: acoustic

Perception Channels: tactile ; echolocation ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

No data is available about the lifespan of Platanista minor. The dolphins probably live for a long time since they are relatively large and require 10 years to reach sexual maturity. However, recent poor water quality and reduced habitat might affect the current longevity of these animals in the wild. At least a few Indus River dolphins have been kept in captivity, however, their longevity data is unavailable.

Average lifespan

Status: wild:
28.0 years.

  • Reeves, R., A. Chaudhry. 1998. Status of the Indus River dolphin Platanista minor . Oryx, 32: 35-44.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

These dolphins probably do not mate seasonally, since calves are born at different times throughout the year. However, in a captive population of two females and a male in Switzerland, the male reportedly chased the females in the spring. Though scattered captive populations of Platanista minor exist, little is known about the mating behavior of any of the members of the Platanistidae family.

Platanista minor breeds throughout the year, and has a very long gestation period of 8-11 months. Though not mentioned in the literature, this species probably only gives birth to one offspring at a time since newborns are about a meter long when they are born, which is nearly half the length of an adult female.

Breeding interval: Platanista minor probably does not breed more than once every two years or so due to such long gestation and nursing periods.

Breeding season: Mating occurs throughout the year.

Range gestation period: 8 to 11 months.

Range weaning age: 2 to 12 months.

Average age at sexual or reproductive maturity (female): 10 years.

Range age at sexual or reproductive maturity (male): 10 (low) years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Little information is available about parental investment in Platanista minor, however, they most likely spend much time and energy on their offspring. Since females are pregnant for up to 11 months, newborns are about half the size of their mothers at birth, calves nurse up to a year after birth, Indus River dolphin offspring are probably very costly.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Herman, L. 1980. Cetacean Behavior: Mechanisms and Functions. New York: John Wiley & Sons, Inc..
  • Moreno, P. 2004. Ganges and Indus dolphins (Platanistidae). Pp. 13-17 in M Hutchins, D Kleiman, V Geist, M McDade, eds. Grzimek's Animal Life Encyclopedia, Vol. Volume 15: Mammals IV, Second Edition Edition. Detroit: Thompson Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Platanista minor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAATCGCTGACTATTCTCAACAAACCACAAAGACATTGGTACTTTATATTTACTATTTGGTGCTTGAGCAGGGATAGTAGGTACCGGCCTAAGCTTACTAATCCGTGCTGAACTAGGTCAACCTGGCACACTAATCGGAGACGACCAAGTCTACAACGTATTAGTAACAGCCCATGCTTTCGTAATAATCTTTTTCATAGTTATACCCATCATAATTGGCGGCTTTGGAAATTGACTTGTCCCTCTAATGATCGGAGCACCCGACATAGCCTTTCCCCGTATAAATAATATAAGCTTCTGACTACTTCCCCCCTCCTTCCTACTACTACTAGCATCTTCAATACTTGAAGCCGGGGCAGGTACGGGCTGAACTGTCTACCCCCCTTTAGCCGGAAACCTAGCACACGCAGGAGCCTCTGTTGATCTTACTATTTTCTCCTTACACTTAGCCGGTTTATCCTCAATCCTCGGGGCCATTAATTTCATTACAACCATTATTAATATAAAACCCCCTGCTATAACTCAATATCAAACACCCCTCTTCGTATGGTCCGTTCTAGTCACAGCAGTCTTACTTCTACTATCACTACCAGTACTAGCAGCTGGAATCACTATACTATTAACTGACCGAAATTTAAATACAACTTTCTTTGACCCGGCGGGAGGAGGAGACCCAATCCTATACCAACATCTCTTCTGATTTTTCGGTCACCCTGAAGTATATATTTTAATTCTACCTGGCTTCGGAATAATTTCACACATCGTAACTTATTATTCAGGAAAAAAAGAACCTTTCGGATATATAGGAATAGTCTGAGCCATAGTCTCCATCGGGTTCTTAGGTTTCATCGTATGAGCCCACCATATATTTACAGTCGGCATAGACGTTGACACACGAGCCTACTTCACATCAGCCACTATAATCATTGCTATTCCCACAGGAGTAAAAGTCTTTAGCTGACTAGCAACACTTCATGGAGGCAATATCAAATGATCCCCTGCCCTGATATGAGCCCTAGGCTTTATTTTCCTATTTACAGTTGGCGGGTTAACTGGCATTGTCTTAGCTAACTCATCACTAGATATTGTACTCCACGACACATACTACGTAGTTGCCCATTTCCACTACGTACTTTCAATAGGAGCAGTTTTCGCCATTATAGGAGGATTTGTCCACTGATTTCCGCTATTCTCAGGATATACACTCAACCCAACATGAGCAAAAATCCATTTTATAATTATATTTGTAGGCGTAAACTTAACATTTTTCCCTCAACATTTCCTAGGCTTATCCGGTATACCCCGACGATACTCCGACTACCCAGATGCTTACACTACATGAAATACTATCTCATCAATAGGTTCTTTCATCTCACTAACAGCAGTTATACTAATAGTCTTCATCATCTGAGAAGCATTTGCATCCAAACGGGAAATCCTAACAGTAACCCTCACCACCACAAACCTCGAATGGCTAAACGGCTGTCCTCCACCATATCATACATTCGAAGAGCCAGTCTACATTAACCCAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Platanista minor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Platanista minor is a species of great concern, and a combination of human-created barriers such as dams and barrages, hunting, and a limited natural range have resulted in a dangerously-low total population of only several hundred individuals. These dolphins are classified as endangered, and have been so since the 1970's. Their extremely low population size may also restrict their gene pool, thus they might soon have many problems associated with low genetic variation within a population.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2abcde; B1ab(i,ii,iii,iv); C1

Version
3.1

Year Assessed
2012

Assessor/s
Braulik, G.T., Smith, B.D. & Chaudhry, S.

Reviewer/s
Reeves, R. & Taylor, B.L.

Contributor/s

Justification
This subspecies meets several of the criteria for listing as Endangered, as follows:

Only very limited data are available on the life history of Platanista sp. (reviewed by Brownell 1984). Age at first reproduction is likely between 6–10 years and maximum longevity may be close to 30. Therefore, generation time is probably more than 10 but possibly less than 20 years, so three generations into the past would be to 1944–1974 and two generations would be 1964–1984.

Subcriterion A2 applies because a population size reduction of more than 50% since 1944 (the longest estimated time of three generations) is inferred and suspected, given that almost all of the critical barrage construction associated with the large-scale decline in the area of occupancy has occurred since that time. Moreover, the reduction and its causes have not ceased (habitat quality is expected to deteriorate further and mortality from canal entrapment continues), are not fully understood, and may not be reversible. The basis could rest on any or all of (a) to (e) with the case strongest for (c).

The linear extent of occurrence of the subspecies is approximately 1,000 km of the Indus River (Reeves et al. 1991, Braulik 2003). Analysis of satellite images indicates that during the dry season the average width of the Indus River is 900 m, meaning that the extent of occurrence for the Indus Dolphin is approximately 900 km², clearly below the 5000 km² threshold for listing as EN under Criterion B1 (Braulik 2004). The area of occupancy of this subspecies is 690 linear km, or 620 km², falling just outside the 500 km² threshold for criterion B2.

The metapopulation presently occurs at no more than five locations (defined as segments of river between two barrages), thereby meeting subcriterion 'a' of B1. Prior to 1990 there were occasional reports of dolphins in the lower Chenab and Sutlej Rivers, but these reports have ceased, implying that the remnant subpopulations in those tributaries have now been extirpated. Subpopulations above Chashma Barrage and below Sukkur Barrage have been reduced in size so that they are almost certainly too small to persist in the long term. Meanwhile, the demand for river water for agricultural, industrial, and urban use continues to escalate, which implies a continuing decline in suitable habitat, and in the number of subpopulations, extent of occurrence, and number of mature individuals, thereby also meeting subcriterion 'b' of B1.

Although the best estimate of about 1,000 individuals made by Braulik (2003) for the total population size may be negatively biased due to availability (i.e., dolphins were submerged when in the field of view of observers) or perception (observers were looking elsewhere or were inattentive), the number is far below the Criterion C threshold of 2,500 mature individuals. Evidence that the Indus population meets this criterion becomes even more compelling when the measures taken by Braulik (2003) to minimize and evaluate sighting biases are considered (see above). Given the rapid escalation in demand for water from the Indus and the likely associated degradation and loss of habitat for the subspecies, it is reasonable and precautionary to estimate that a 20% or greater reduction in population size is likely to occur in the next two generations (20–40 years). The subspecies therefore also qualifies for listing as EN according to Criterion C1.

History
  • 2004
    Endangered
  • 1996
    Endangered
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 01/14/1991
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Platanista minor , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Direct-count surveys of the largest subpopulations have been conducted regularly by the Sindh and Punjab Wildlife Departments since the early 1980's, but described methods do not provide a basis for evaluating bias, estimating precision, or detecting trends in abundance (Reeves and Chaudhry 1998). Dolphin counts between Guddu and Sukkur Barrages show an apparent increase from 139 dolphins recorded in 1974 (Pilleri and Zbinden 1973–74), to 290 in 1979 (Pilleri and Bhatti 1980), and 458 dolphins in 1996 (Mirza and Khurshid 1996). If this increase was real and not an artifact of variable sighting biases, it could be explained by recovery of the subpopulation after implementation of a hunting ban in 1974 (see Conservation Actions below) or by permanent immigration from upstream subpopulations (see Major Threats below). A comprehensive review of previous survey data is presented in Reeves and Chaudhry (1998) and Reeves et al. (1991).

The most recent and comprehensive assessment of the Indus Dolphin population was a survey of their entire range conducted in March and April 2001 that resulted in a minimum abundance estimate of 965 dolphins (based on the sum of best estimates of group size of all sightings). High and low estimates of group size were also recorded. The sum of high estimates was 1,171 and the sum of the low estimates 843. This survey also documented a pronounced increase in the abundance and encounter rate of dolphins as the survey vessel proceeded downstream. The largest subpopulation is located in the Sindh Dolphin Reserve between the Guddu and Sukkur Barrages, at the downstream end of the range. Best estimates of 602 total dolphins and 3.6 dolphins/linear km were recorded for this section, 259 dolphins and 0.74 dolphins/linear km for the section between Guddu and Taunsa, and 84 dolphins and 0.28 dolphins/linear km for the furthest upstream section between Taunsa and Chashma. Two dolphins were seen upstream of Chashma Barrage and 18 downstream of Sukkur Barrage.

The minimum abundance estimate of 965 dolphins for the subspecies is likely to be close to the actual population size due to measures taken in the field to increase sighting efficiency. Essentially all potential dolphin habitat was surveyed in the Indus mainstem, including secondary channels and braids off the main channel, from a non-motorized vessel (mean survey speed = 5 km/hr), which maximized detection opportunities. Double-concurrent counts were also conducted from a second vessel traveling behind the primary survey vessel. Sightings were considered unique if they were greater than 750 m distant from another group according to the GPS positions. Preliminary analyses indicate that the primary survey vessel missed less than 10% of dolphin groups, and no groups of more than 3 individuals (mean group size recorded was 2.0; SD = 1.6; range 1–11) (Braulik 2004). The probability of double counting dolphins due to their movement from surveyed to unsurveyed areas overnight was considered to be balanced by the probability that an equal number of dolphins were missed altogether due to their movements in the opposite direction.

The linear extent of occurrence of the subspecies has declined from approximately 3,400 km of Indus mainstem and its tributaries in the 1870s (see Anderson 1879) to approximately 1,000 linear km of the mainstem today (Braulik 2004). An estimated 99% of the dolphin population occurs in only 690 linear km, which corresponds to an 80% reduction in the area of occupancy (Anderson 1879, Reeves et al. 1991, Braulik 2003, Braulik 2004). During the 1970s and 1980s there were occasional reports of dolphin occurrence between barrages in the lower reaches of the Indus tributaries (Reeves et al. 1991). No recent surveys have been conducted in those areas. However, due to an increase in upstream water abstraction and a decline in dry season flows, it is unlikely that any dolphins remain in these reaches.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The most significant threat to dolphins in the Indus has been the construction of at least 25 dams and barrages that have severely fragmented the population and reduced the amount of available habitat (Smith and Reeves 2000). Upstream subpopulations may lose individuals downstream if dolphins move through barrage gates when they are open in the wet season. Individuals are unlikely to move upstream through a barrage because of strong downstream hydraulic forces at the gates. While there have been no direct observations of dolphins moving through a barrage, they often swim through regulator gates into irrigation canals, which, although smaller, present a similar obstacle (Braulik 2002). Evidence for permanent downstream emigration includes that each subsequent downstream subpopulation is larger than the one above (see Range and Population above), despite the reduced linear extent and availability of water in downstream segments. Encounter rates in the farthest downstream subpopulation (between Guddu and Sukkur Barrages) are very high (3.60 dolphins/linear km), approaching three times those recorded in similar surveys elsewhere for Platanista dolphins (Braulik 2003). The possible large increase in the dolphin subpopulation between Guddu and Sukkur Barrages (described above) may be due to reproduction and reduced mortality alone, or may be augmented by downstream emigration. Even a low emigration rate could dramatically affect the persistence of upstream subpopulations (Reeves et al. 1991, Reeves and Smith 1999).

Since the mid 1990s, there have been increasing reports of dolphins trapped in irrigation canals near Sukkur Barrage. Dolphins have survived for several months in the canals until they are drained in January for annual de-silting and maintenance. Between January 2000 and December 2002, 34 dolphins were reported trapped in these canals. Twenty-four were successfully rescued and returned to the Indus River, while the remainder died (Bhaagat 1999, Braulik 2002, WWF-Pakistan unpublished data).

One of the direst threats to the survival of the Indus River Dolphin is probably the escalating demand for water. Pakistan is a largely desert nation, with a rapidly growing human population and fast developing industrial and agricultural sectors that demand increasing amounts of water. Several years of extreme drought have depleted aquifers that would normally be expected to augment river flows in the dry season.

Pollution may be affecting the viability of the subspecies, especially considering the decline in flushing and dilution due to reduced flows. The Indus River corridor is not highly developed and above the Panjnad River confluence, the habitat is likely to be relatively unpolluted. However, more than 75% of the dolphin population occurs downstream of the confluence with the Panjnad River, which receives a large pollution load from the industrialized cities of the Punjab. There are almost no facilities for treatment of municipal waste in Pakistan and few controls on industrial effluent. Massive fish kills have reportedly become common from industrial pollution in urban areas and from pesticides used on irrigated crops grown along the riverbanks (Reeves and Chaudhry 1998). The pressures on river water supply and continued untreated discharge of pollutants imply that there will be a continuing decline in the amount and quality of dolphin habitat.

Deliberate killing for meat and oil was a traditional and widespread practice until at least the early 1970s (Pilleri and Zbinden 1973–74). Hunting is now banned although poaching occasionally occurs. Similar to all cetaceans, this subspecies is vulnerable to entanglement in fishing gear and vessel collisions. However, the areas of the Indus River where dolphins are extant are not heavily fished or utilized by vessels and these factors may not be major threats at present. Incidents of accidental killing and observations of dolphin carcasses and products are documented in Reeves et al. (1991) and Reeves and Chaudhry (1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In 1972, dolphins were protected under the Wildlife Act of Sindh and in 1974 the government of Sindh declared the Indus River between the Sukkur and Guddu Barrages a dolphin reserve. The government of Punjab prohibited deliberate killing of dolphins in the Punjab Wildlife Protection Act in 1974 and established the Taunsa Wildlife Sanctuary and Chashma Wildlife Sanctuary in 1983 and 1984, respectively (Reeves et al. 1991, Reeves and Chaudhry 1998, Chaudhry and Khalid 1989). Enforcement of regulations prohibiting dolphin hunting appears to have arrested the rapid population declines reported by Pilleri and Zbinden (1973–74) for these river segments. A programme sponsored by the United Nations Development Programme (UNDP) to rescue dolphins trapped in irrigation canals and return them to the Indus mainstem has had some success in reducing mortality (Braulik 2002, Bhaagat 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse affects of Platanista minor on humans, though no one knows what might happen to the river ecosystem if these highly-endangered animals eventually become extinct. At the very least, however, Pakistan will lose part of its biodiversity forever if the country does not take steps to protect this unique dolphin.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Some people hunt Indus River dolphins for their meat and oil. People in some areas eat the dolphin meat, while others use it as a fishing lure, though studies indicate that fish flesh is just as effective. The dolphin’s oil is used for medicinal purposes, its supposed effectiveness as an aphrodisiac, and to rub on one’s skin.

Positive Impacts: food ; source of medicine or drug

  • Sinha, R. 2002. An alternative to dolphin oil as a fish attractant in the Ganges River: conservation of the Ganges River dolphin. Biological Conservation, 107: 253-257.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Endangered (EN)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Indus River dolphin

Indus River dolphin

The Indus River dolphin (Platanista minor) is a sub-species of freshwater or river dolphin found in the Indus River (and its Beas and Sutlej tributaries) of Pakistan. From the 1970s until 1998, the Ganges River dolphin and the Indus dolphin were regarded as separate species; however, in 1998, their classification was changed from two separate species to subspecies of a single species (see taxonomy below).

Contents

Other names

  • Both subspecies: South Asian river dolphin, blind river dolphin, side-swimming dolphin
  • Ganges subspecies: Gangetic dolphin, Ganges Susu,[2] Shushuk
  • Indus subspecies: Bhulan, Indus dolphin, Indus blind dolphin

Taxonomy

The long jaws and deep brain pan of the Indus River dolphin are visible from this skull cast. From the collection of The Children's Museum of Indianapolis.

The species was described by two separate authors Lebeck and Roxburgh in the year 1801 and it is unclear to whom the original description should be ascribed.[3] Until the 1970s the Indus and Ganges River dolphins were regarded as a single species. The two populations are geographically separate and have not interbred for many hundreds if not thousands of years. Based on differences in skull structure, vertebrae and lipid composition scientists declared the two populations as separate species in the early 1970s.[4] In 1998 the results of these studies were questioned and the classification reverted to the pre-1970 consensus of a single species containing two subspecies until the taxonomy could be resolved using modern techniques such as molecular sequencing. Thus, at present, there are two subspecies recognized in the genus Platanista, Platanista minor (the Indus dolphin) and Platanista gangetica (the Ganges River dolphin).[5]

Physical description

The Indus dolphin has the long, pointed nose characteristic of all river dolphins. The teeth are visible in both the upper and lower jaws even when the mouth is closed. The teeth of young animals are almost an inch long, thin and curved; however, as animals age the teeth undergo considerable changes and in mature adults become square, bony, flat disks. The snout thickens towards its end. The species does not have a crystalline eye lens, rendering it effectively blind, although it may still be able to detect the intensity and direction of light. Navigation and hunting are carried out using echolocation. The body is a brownish colour and stocky at the middle. The species has only a small triangular lump in the place of a dorsal fin. The flippers and tail are thin and large in relation to the body size, which is about 2-2.2 metres in males and 2.4–2.6 m in females. The oldest recorded animal was a 28 year old male 199 centimetres in length.[6] Mature adult females are larger than males. Sexual dimorphism is expressed after females reach about 150 cm; the female rostrum continues to grow after the male rostrum stops growing, eventually reaching approximately 20 cm longer. Calves have been observed between January and May and do not appear to stay with the mother for more than a few months. Gestation is thought to be approximately 9–10 months.

The species feeds on a variety of shrimp and fish, including carp and catfish. Dolphins are usually encountered on their own or in loose aggregations; they do not form tight, obviously interacting groups.

Human interaction

The Indus river dolphin has been very adversely affected by human use of the river systems in the sub-continent. Entanglement in fishing nets can cause significant damage to local population numbers. Some individuals are still taken each year and their oil and meat used as a liniment, as an aphrodisiac and as bait for catfish. Irrigation has lowered water levels throughout their ranges. Poisoning of the water supply from industrial and agricultural chemicals may have also contributed to population decline. Perhaps the most significant issue is the building of dozens of dams along many rivers, causing the segregation of populations and a narrowed gene pool in which dolphins can breed. There are currently three sub-populations of Indus dolphins considered capable of long-term survival if protected.[7]

The Indus river dolphin is listed by the IUCN as endangered on their Red List of Threatened Species [1] and also by the U.S. government National Marine Fisheries Service under the U.S. Endangered Species Act.

See also

South Asian river dolphin

References

  1. ^ a b Smith, B. D. and G. T. Braulik (2008). Platanista gangetica. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 14 December 2008. Database entry includes justification for why this species is endangered
  2. ^ "Susu, the blind purpoise ... in the Ganges River, blind porpoise of Asia". The New Book of Knowledge, Grolier Incorporated. 1977. , page 451 [letter A] and page 568 [letter S].
  3. ^ Kinze, C.C. (2000). "Rehabilitation of Platanista gangetica (Lebeck, 1801) as the valid scientific name of the Ganges dolphin". Zoologische Mededelingen Leiden ([1]) 74: 193–203. 
  4. ^ Pilleri, G., G. Marcuzzi and O. Pilleri (1982). "Speciation in the Platanistoidea, systematic, zoogeographical and ecological observations on recent species". Investigations on Cetacea 14: 15–46. 
  5. ^ Rice, DW (1998). Marine mammals of the world: Systematics and distribution. Society for Marine Mammalogy. ISBN 978-1891276033. 
  6. ^ Kasuya, T., 1972. Some information on the growth of the Ganges dolphin with a comment on the Indus dolphin. Sci. Rep. Whales Res. Inst., 24: 87–108
  7. ^ Braulik, G. T. (2006). "Status assessment of the Indus River dolphin, Platanista gangetica minor, March–April 2001". Biological Conservation 129: 579–590. doi:10.1016/j.biocon.2005.11.026. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!