Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

Dorylus (Rhogmus) fimbriatus laevipodex Santschi, 1919b PDF: 232 (m.) KENYA. AntCat AntWiki
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Un peu plus robuste que le type. Le gastre atteint 7.3 mm. de large; l'aile anterieure, 23 mm. Le tiers moyen du bord externe des mandibules est peu ou pas redresse et non concave. Pygidium depourvu de pubescence; il y a seulement des poils couches longs et fins tres clairsemes, de facon que le segment paraisse entierement lisse et luisant.

 

Afrique orientale anglaise.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus laevipodex

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTTGCATTATGATCTGGAATTTTAGGATCATCAATAAGAATAATTATCCGTTTAGAATTAGGAACTTGCGGAACCATAATTTCTAAT---GATCAAGTTTTCAACGCTCTTATTACTAGACATGCATTTATTATAATTTTTTTTATAGTAATACCATTTATAATTGGGGGATTTGGTAATTTTATCGCCCCATTAATAATTGGGGCCCCAGATATAGCTTACCCTCGTATGAATAATATAAGATTTTGATTACTCCCCCCGTCAATTACTTTAATAATTAGAAGAAACTTTATCAATAGGGGGCCTGGAACAGGATGAACAGTTTACCCGCCTTTGGCATCTAGTATTTATCATAGAGGGGCTTCAATTGATTTAACTATTTTTTCATTACATATTGCTGGCATATCATCAATTTTAGGGGCTATTAATTTTATTTCTACTATTATTAATATACACCATAAAAGATTAACAATAGATAAAACTCCATTATTTGTTTGATCAATTTTAATTACAGCAATCTTATTATTATTATCTCTCCCAGTTTTAGCAGGAGCAATTACTATATTATTAACAGATCGAAATATTAATACTTCATTTTTTGACCCATCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus laevipodex

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!