Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Dorylus (Anomma) emeryi Mayr subspecies opacus Forel HNS

A fine series of workers of all sizes from a single colony taken at Ngayu (Lang and Chapin). "They appeared during the night, apparently attracted by some bones of large mammals, which they completely covered." The sides of the head of the largest workers are less convex than indicated by Santschi's figure and like that which he gives of D. emeryi HNS , though slightly narrower and much more deeply excavated behind. The preapical tooth of the mandibles is lacking in the largest, though present in the mediae and smallest workers. There are also three workers from Medje, taken from the stomach of a toad (Bufo funereus).

  • Wheeler, W. M. (1922): The ants collected by the American Museum Congo Expedition. Bulletin of the American Museum of Natural History 45, 39-269: 43-43, URL:http://plazi.org:8080/dspace/handle/10199/17097
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Taxonomic History

Dorylus emeryi subsp. opaca Forel, 1909b PDF: 58 (w.) DEMOCRATIC REPUBLIC OF CONGO. AntCat AntWiki

Taxonomic history

Forel, 1911l PDF: 452 (m.).
Raised to species: Santschi, 1912b PDF: 154 (in key); Forel, 1916 PDF: 402.
Currently subspecies of Dorylus emeryi: Wheeler, 1922: 43.
See also: Stitz, 1910: 127; Forel, 1913i PDF: 348.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Wheeler, W. M., 1922:
  A fine series of workers of all sizes from a single colony taken at Ngayu (Lang and Chapin). "They appeared during the night, apparently attracted by some bones of large mammals, which they completely covered." The sides of the head of the largest workers are less convex than indicated by Santschi's figure and like that which he gives of D. emeryi , though slightly narrower and much more deeply excavated behind. The preapical tooth of the mandibles is lacking in the largest, though present in the mediae and smallest workers. There are also three workers from Medje, taken from the stomach of a toad (Bufo funereus).
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A fine series of workers of all sizes from a single colony taken at Ngayu (Lang and Chapin). "They appeared during the night, apparently attracted by some bones of large mammals, which they completely covered." The sides of the head of the largest workers are less convex than indicated by Santschi's figure and like that which he gives of D. emeryi , though slightly narrower and much more deeply excavated behind. The preapical tooth of the mandibles is lacking in the largest, though present in the mediae and smallest workers. There are also three workers from Medje, taken from the stomach of a toad (Bufo funereus).

License not applicable

Wheeler, W. M.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- [[ soldier ]]. (non decrit). Long. 11 mill. - D'un brun rougeatre fonce, la tete d'un brun plus fonce. Mat. Angles anterieurs de la tete, mandibules, antennes, pattes et' pygidium subopaques. (Chez emeryi le vertex est lisse et luisant.)

 

Tete plus allongee que chez emeryi , plus retrecie et plus profondement echancree en arriere. Les aretes frontales sont un peu plus ecartees que chez emeryi . Les mandibules sont plus allongees et ne possedent que deux dents, la preapicale qui est encore tres nette chez les gros soldats d' emeryi fait ici completement defaut. En revanche, Ja dent basale est plus forte et plus epaisse ainsi que la base des mandibules. Le pronotum est un peu plus allonge et moins epaule. Pour le reste, comme chez emeryi .

 

[[ male ]]. Long. 28 mill. - Brun roussatre. Tete noiratre. Mandibules, antennes et pattes brun rouge. De longs poils blonds, ondules, recouvrent tout l'espace compris entre les yeux et les cretes frontales, depuis l'epistome jusqu'a l'occiput. Il y a, en outre, une touffe de poils qui s'inserent sur la base des mandibules. D'autres poils semblables abondent sur la face basale de l'epinotum, sous le thorax et les hanches. Ils sont moins denses sous la tete, les cotes du pedicule et assez clairsemes sur le pronotum et le dessus du pedicule. Thorax et abdomen couverts d'une pubescence soyeuse doree assez longue comme chez depilis Em. Mandibules, pattes, bords des segments du gastre un peu luisants. Tete deux fois plus large que haute, bien moins haute (du bord anterieur de l'epistome au vertex) que chez nigricans Ill . avec un bord superieur bien moins arque, toutefois plus arque que chez atratus Sm. Les yeux sont aussi convexes et saillants que chez cette derniere espece. Les mandibules sont seulement trois fois aussi longues que larges a leur base (plus larges que chez atratus ) avec un bord interne plus sinueux. Les deux premiers articles du funicule sont lisses et luisants. Le scape est plus court que chez nigricans . Le thorax plus allonge et plus etroit que chez cette derniere espece, avec un scutellum plus retreci en arriere (moins arrondi). Petiole cupuliforme proportionnellement plus court que chez nigricans . Ailes d'un jaune un peu brunatre avec les nervures brunes. Armure genitale longue de 6.5 mill, brun fonce avec la convexite dorsale plus mediane et moins prononcee que chez nigricans . Longueur de l'aile anterieure 19 mill., largeur de la tete 5.1 mill., hauteur 2.3 mill., largeur maxima du thorax 5 mill.

 

La decouverte du [[ male ]] d' Anomma opacus le place tout pres du genre Dorylus s. str ., a moins qu'on ne rattache egalement au genre Anomma les Dorylus atratus Sm. gribodoi Em. et stadelmanni Em. dont on ne connait pas encore les ouvrieres et dont l'un d'eux pourrait etre le [[ male ]] de D. Anommagerstaeckeri Em. Si cela est, la caracteristique des [[ male ]] du s. g. Anomma serait surtout la glabreite complete des deux premiers articles du funicule tandis que le 2 me article serait pubescent en dessous dans le s. g. Dorylus s. str.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorylus opacus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTCTATGATCAGGAATTTTGGGATCATCAATAAGAATGATTATTCGTTTAGAATTAGGCACATGTGGAACAATAATTTTTAAT---GATCAAGTTTTTAATGCTATTGTCACTAGACATGCATTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTTGGAAATTTTATTGCCCCCTTAATAATCGGAGCCCCTGATATAGCTTATCCTCGAATAAATAATATAAGATTTTGATTATTACCGCCATCTATTACTTTAATAATTACAAGAAATTTTATTAGAGGAGGACCAGGAACCGGATGAACTGTTTACCCTCCATTAGCATCAAATATTTATCATAGAGGGGCTTCAATTGATTTAACTATTTTTTCATTACATATTGCTGGGATATCCTCCATTTTAGGCGCAATTAATTTTATTTCTACAATTATTAATATACATCATAAAAACTTAACTATAGATAAAACTCCATTATTTGTTTGATCAATTTTAATTACAGCTATTCTGCTACTTCTCTCTCTACCAGTATTGGCAGGAGCTATTACTATACTATTAACTGATCGAAATATTAATACTTCATTTTTTGATCCCTCTGGAGGAGGCGACCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus opacus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!