Overview

Comprehensive Description

Biology

Migratory species which breeds in the ocean (Ref. 52331, 79840). Lives in fresh water areas as an adult, in estuaries and seas as young (Ref. 12693). Descends to the sea to spawn. Inhabits freshwater streams and pools, preferring marshy habitats (Ref. 41236). Found in rivers and creeks, commonly over rock bottoms and in deeper pools. Seldom occurs in large rivers (Ref. 6028). Restricted to lowland (coastal) reaches of river systems (Ref. 7248). Feeds on small fishes, crustaceans and mollusks. Reported to breed east of Madagascar; the south equatorial current probably carries the eel larvae and elvers towards the east coast of Africa where local coastal currents guide the elvers to suitable rivers which they invade and they stay there until sexually mature, when they return to their breeding grounds (Ref. 13337). Caught with various types of nets. Sometimes used in the aquarium trade (Ref. 6028).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: widespread in the tropical Indian Ocean and western Pacific. Known in Australia only from streams in the Kimberley regions of northern western Australia. Africa: widespread but relatively uncommon along east and southeast African coast and Madagascar (Ref. 7248). Mozambique; Lower Zambezi River (Ref. 39494). Most easily confused with Anguilla obscura and the surest way to distinguish them is by the count of vertebrae (Ref. 9828).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 240 - 245; Analspines: 0; Analsoft rays: 200 - 220; Vertebrae: 105 - 115
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

120 cm TL (male/unsexed; (Ref. 48660)); max. reported age: 20 years (Ref. 48660)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Olive to dark bluish-brown dorsally, lighter ventrally from jaw to anus (Ref. 3971). Dorsal body color uniform (Ref. 79840). Dorsal fin origin above vent (Ref. 12693). Teeth small, inconspicuous, multiserial, forming broad continuous bands on jaws and vomer; vomerine tooth-band extending as far back as bands of upper jaw but more pointed posteriorly (Ref. 4832).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Zambezi River Demersal Habitat

This taxon is one of a number of demersal species in the Zambezi River system of southern Africa. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

Nutrient levels in the Zambezi River are relatively low, especially in the upper Zambezi; in that reach, above Victoria Falls, most of the catchment drains Kalahari sands, whose nutrient levels are inherently low due to their aeolian formation; moreover, agricultural fertilizer addition throughout the Zambezi watershed is low, due to the shortage of capital available to farmers of this region.

Nitrate levels (as nitrogen) in the upper Zambezi are typically in the range of .01 to .03 milligrams per liter. Correspondingly electrical conductivity of the upper Zambezi is on the order of 75 micro-S per centimeter, due to the paucity of ion content. From the Luangwa River downstream nitrate levels elevate to .10 to .18 milligrams per liter, and electrical conductivity rises to a range of two to four times the upper Zambezi levels. Not surprisingly, pH, calcium ion concentration, bicarbonate and electrical conductivity are all higher in portions of the catchment where limestone soils predominate compared to granite.

There are a total of 190 fish species present in the Zambezi River, including eel and shark taxa. The largest native demersal species present are the 117 centimeter (cm) long tiger fish (Hydrocynus vittatus), the 175 cm African mottled eel (Anguilla bengalensis labiata), the 120 cm Indonesian shortfin eel (Anguilla bicolor bicolor), the 200 cm Giant mottled eel (Anguilla marmorata), the 150 cm African longfin eel (Anguilla mossambica), the 183 cm Sampa (Heterobranchus longifilis), the 150 cm Cornish jack (Mormyrops anguilloides) and the 700 cm largetooth sawfish (Pristis microdon).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

demersal; catadromous (Ref. 51243); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anguilla bicolor bicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTCTCTACTAATCACAAAGACATTGGTACCCTATATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCATTAAGCCTTCTAATCCGTGCCGAATTAAGTCAACCAGGCGCCCTTCTTGGAGATGACCAAATTTACAATGTCATCGTCACAGCGCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAGTAATAATTGGAGGGTTTGGCAACTGACTTGTACCATTAATAATCGGTGCCCCAGACATGGCATTTCCCCGAATAAATAATATAAGCTTCTGACTCTTACCCCCATCATTTCTTCTCCTACTAGCCTCTTCAGGAGTAGAGGCTGGAGCTGGTACAGGTTGAACTGTATATCCCCCTCTAGCTGGGAATTTAGCCCATGCTGGAGCATCTGTCGACCTGACAATTTTCTCACTTCACCTTGCAGGAGTTTCATCAATCCTGGGAGCCATTAATTTTATTACTACAATTATTAACATGAAACCGCCTGCCATTACACAATACCAAACCCCTCTGTTTGTATGAGCTGTTTTAGTCACCGCTGTTCTGCTGCTCCTATCCCTACCAGTCCTAGCTGCAGGAATTACAATACTTCTGACTGACCGAAACTTAAATACAACATTCTTTGACCCTGCAGGAGGCGGAGACCCAATCCTCTACCAACATCTATTCTGATTCTTTGGCCACCCAGAAGTATACATTTTAATCTTACCAGGATTTGGAATAATCTCACACATTGTTGCTTATTATTCCGGTAAAAAAGAACCATTTGGGTATATAGGAATGGTTTGAGCAATGATGGCTATCGGACTTCTAGGATTCATTGTATGAGCACACCACATGTTTACAGTAGGAATAGACGTAGACACCCGTGCTTACTTCACTTCCGCCACAATAATCATCGCAATTCCAACTGGGGTAAAAGTATTCAGCTGACTAGCCACATTACATGGAGGAGCCATCAAATGAGAAACCCCCCTCCTTTGAGCCCTAGGTTTTATTTTCCTATTTACAGTTGGTGGTCTAACAGGCATCGTACTAGCAAACTCCTCAATCGACATTGTATTACATGACACATACTATGTAGTAGCTCATTTCCACTATGTTCTATCCATAGGAGCAGTCTTTGCTATTATAGGGGGCTTTGTACACTGATTCCCCCTATTCTCAGGATATACACTGCACGACACATGAACCAAAGTACACTTCGGAATTATATTCGTAGGGGTAAACCTAACCTTCTTCCCACAACATTTCCTAGGATTGGCAGGAATACCACGACGTTATTCAGACTACCCAGATGCCTACACCCTATGAAACACAATCTCCTCTATTGGGTCACTAATCTCCCTCACAGCCGTAGTTCTGTTCCTATTTATTCTCTGAGAAGCATTTACTGCCAAACGAGAGGTAAAATGAGTAGAACTCACAGAAACAAATGTTGAATGACTACACGGATGTCCTCCACCATACCACACATTCGAAGAACCAGCGTACGTCCGAGTTCAACCGCCCTCAGATGATAAAAAATCAGAAGCCAAAGCCCATATTCAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anguilla bicolor bicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Indonesian shortfin eel

The Indonesian shortfin eel, Anguilla bicolor bicolor, is a subspecies of eel in the genus Anguilla of the family Anguillidae. It is found throughout the tropical coastal regions of the Indian ocean and Western Pacific.[1]

Showing the typical habits, diet and characteristics of the genus, this species grows to 1.2 m and can live for up to 20 years. Dorsal fin soft rays number 240–250, anal fin soft rays 200-220, Vertebrae between 105 and 109 in number. This fish is lighter underneath, being olive/blue-brown on top. It is easily confused with the Pacific shortfin eel, Anguilla obscura.

References[edit]

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2006). Anguilla bicolor bicolor in FishBase. June 2006 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!