Overview

Brief Summary

Biology

The common wallaroo is often solitary, occupying a relatively small, stable home range near to a rocky outcrop or water, and moving out of rough country to graze on grasses and shrubs in adjoining areas (2) (4) (9). Small groups sometimes form around favoured resources, but are usually quite loose in size and composition (2) (6). The common wallaroo is able to survive harsh conditions by using caves and rocky outcrops for shelter, and appears to be able to go for as much as two to three months without drinking, surviving solely on the water contained in food plants (2) (9). The common wallaroo is believed to be polygynous (6) and is an opportunistic breeder, able to breed throughout the year, although often ceasing reproduction during prolonged droughts (2) (8) (10). A single, tiny young is born after a gestation period of 30 to 38 days (8), after which it climbs, unaided, through the female's fur and into the pouch, where it attaches to a teat and begins to suckle (11). Most development takes place within the pouch, the young common wallaroo emerging after around 231 to 270 days (8). The young is suckled for at least 12 to 14 months, with males reaching sexual maturity at around 18 to 20 months in captivity, and females at 14 to 24 months (8). Individuals may live for over 18 years in the wild (2). In a process known as embryonic diapause, the female common wallaroo is able to become pregnant again shortly after giving birth. However, the new embryo remains dormant until the first young is ready to leave the pouch or is lost, after which the embryo resumes development and is born when the pouch is vacant. This unusual form of reproduction, found in many kangaroos, means the female can quickly replace young lost to predators or drought, and can have embryos ready to develop as soon as conditions become favourable (2) (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The common wallaroo is a rather stocky kangaroo with coarse, shaggy fur, a hairless muzzle, a relatively short, thick tail, and a distinctive upright hopping style (2) (3) (4) (5). The robust body shape, with shorter limbs than other kangaroos, may be an adaptation for leaping around on rocks, and the short, broad hind feet have roughened soles to give extra grip (4). The male common wallaroo is up to twice the size of the female, and has particularly thick-set shoulders and forearms (4) (6). Coat colour varies from reddish-brown to a very dark blue-grey, almost black, and is generally lighter on the underparts (4). Four subspecies are recognised, based mainly on colour, size, and genetic differences: Macropus robustus robustus (eastern wallaroo), Macropus robustus erubescens (inland wallaroo or 'euro'), Macropus robustus woodwardi (northern wallaroo), and Macropus robustus isabellinus (Barrow Island wallaroo). In some areas, M. r. robustus and M. r. erubescens overlap and are thought to hybridise (4). The Barrow Island wallaroo, M. r. isabellinus, is the most distinctive of the subspecies, being smaller and stockier, reaching only half the size of the other forms (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species ranges throughout much of Australia. The subspecies Macropus robustus isabellinus is known only from Barrow Island, off the Pilbara coast of Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Inhabits most regions of Australia, including Central Australia, Cape York Penninsula of Queen Island in Northeastern Australia, the rocky areas of Hodgson in Northern Australia and the Victoria region.

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The common wallaroo is widely distributed throughout most of Australia, except Tasmania (1) (2), although the distribution is rather patchy due to the discontinuous nature of the habitat (4). M. r. robustus occurs in eastern Australia, from southern New South Wales to Queensland, M. r. erubescens occurs over much of the drier areas of the continent, from western New South Wales and Queensland, west to the Indian Ocean coast, and M. r. woodwardi occurs across northwestern Australia (4). M. r. isabellinus is found only on Barrow Island, off the coast of Western Australia (1) (4) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Macropus robustus is one of the largest and heaviest of the macropodid family, with mature males attaining twice the weight of mature females. Wallaroos are stout and heavy with a head to tail length of 1138-1986 mm (males) and 1107-1508 mm (females). The tails are about 551-901 mm (males) and 534-749 mm (females). The pelage is darker (greyish-black) than most others in the Macropodidae, and it is of medium length and directed downwards. The fur is less dense than that of red and grey kangaroos and includes thin and sparse underfur. The color of the fur is dark grey on the dorsal side and pale to nearly white on the ventral side. The muzzle has a bare black rhinarium and a slight lateral inflation. The nasal region and the back of the ears are black, while the lips, the inside and base of the ears are white or pale. The legs and tail have a very dark brown color that bleeds into a black tint near the tips of both extremeties. The teeth have vertically placed roots in the second and third incisors. The second incisor has enamel that covers about the height and length of the crown. The outer face of the tooth has an indistinct groove. The third incisor is long and equals the combined length of the first and second incisors and also has an external notch near the front edge. The third premolar is about 7 mm in length and the fourth premolar is large and powerful. The molars have well developed transverse ledges with connecting ridges that are small and sometimes absent. The stance isdistinctive: the shoulders are thrown back, elbows tucked into the sides and wrists raised. Strahan 1995; Tyndale-Biscoe 1973; Nowak 1991

Range mass: 6.75 to 35.75 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 33.056 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is generally found in varied habitats, usually with steep escarpments, rocky hills, overhangs, and caves that provide shelter during periods of high temperature (Clancy and Croft 2008). It also shelter in dense shrub around streams. The species grazes on grasses and shrubs.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Macropus robustus is found in many regions of Australia. They can survive where the temperatures rises to 120 F and where the average rainfall is less than 380 mm/year. They prefer rocky places for shade and can inhabit regions of sparse vegetation. Strahan, 1995; Tyndale-Biscoe, 1973; Nowak, 1991

Terrestrial Biomes: desert or dune ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Often referred to as a 'hill kangaroo', the common wallaroo typically inhabits mountainous areas, rocky hills and steep escarpments, although it may also use stony rises, grasslands and plains (2) (4) (7) (8). Caves, overhanging rocks and ledges are often used for shelter, particularly from extreme heat, and as refuges from predation (1) (2) (4) (8). The species may also shelter in dense shrub around streams (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Wallaroos are herbivores that do not require much water or highly nutritious foods. They drink less frequently than most species in the family and eat foods that have lower nutritional value. They mainly feed on spinifex, soft grasses, shrubs, herbs and low protein/ low fiber grasses. In the spring they graze on grass inflourescences and forbs. Strahan, 1995; Tyndale-Biscoe, 1973.

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
18.5 years.

Average lifespan

Status: captivity:
19.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22 years (captivity) Observations: It has been estimated that they can live up to 24 years in the wild (Fisher et al. 2001). Record longevity in captivity, however, is 22 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Wallaroos reach sexual maturity before two years of age. They are opportunistic breeders with no regular seasonal pattern of reproduction. Under good breeding conditions, nearly all females have one running offspring and one attached to a teat in the pouch. Under poor breeding conditions, females experience embryonic diapause. The gestation period is about 34 days and the pouch life ranges from 237-269 days. Strahan,1995; Tyndale-Biscoe, 1973; Thomas, 1888; Nowak, 1991

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 0.703 g.

Average gestation period: 32 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
670 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
547 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macropus robustus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0533-06|NC_001794|Macropus robustus| ACTCGTTGACTATTTTCAACTAATCATAAAGATATTGGCACACTATATCTCCTATTTGGTGCCTGAGCAGGTATAGTAGGAACTGCCTTA---AGTCTGCTCATTCGTGCAGAACTCGGTCAGCCTGGCACCCTGCTCGGAGAT---GATCAAATTTACAATGTCATTGTTACTGCCCATGCCTTTGTAATAATTTTCTTCATGGTAATACCTATTATAATTGGAGGTTTCGGTAACTGATTGGTGCCTTTAATA---ATTGGTGCCCCCGATATGGCATTCCCGCGAATAAATAACATGAGCTTCTGACTCTTACCACCATCCTTCCTTCTTCTATTAGCATCCTCAACAGTAGAGGCAGGGGCAGGCACAGGATGGACCGTATATCCCCCATTAGCTGGAAATCTAGCCCACGCAGGAGCTTCAGTAGATTTA---GCTATTTTCTCCCTCCACCTGGCAGGTGTATCATCCATTCTAGGAGCTATTAATTTTATTACTACAATTATTAACATGAAACCACCGGCCCTAACTCAATACCAAACCCCACTATTCGTATGGTCCGTAATAATTACAGCAGTCCTCCTTCTCCTTTCACTACCAGTCTTAGCAGCT---GGTATTACAATACTCCTAACAGATCGAAACCTAAACACAACATTTTTCGATCCTGCTGGGGGTGGAGACCCAATCCTGTACCAACATCTTTTCTGATTTTTTGGTCACCCAGAAGTTTACATTTTAATTCTCCCAGGATTTGGCATAATCTCTCACATCGTAACCTACTATTCCGGTAAAAAA---GAACCTTTCGGTTATATGGGTATGGTTTGAGCTATAATGTCTATCGGATTCCTAGGTTTCATCGTTTGAGCTCACCATATATTCACAGTCGGACTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macropus robustus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Ellis, M., Menkhorst, P., van Weenen, J., Burbidge, A., Copley, P., Denny, M., Woinarski, J., Mawson, P. & Morris, K.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, large population, occurrence in a number of protected areas, lack of major threats, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

In Victoria, wallaroos are in urgent need of protection. Due to their isolation, they are vulnerable to factors such as predation and human land development. In Victoria they are classified as rare. In all other areas that are known to contain wallaroos, however, the populations are abundant. Warneke, R.M. 1995. Mammals of Victoria: Distribution, Ecology and Conservation. Oxford University Press, Australia. 189.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is widespread and relatively common in appropriate habitats. It is sparse in the wheatbelt of New South Wales, common in other areas of its range. In Queensland, it is common in some agricultural areas with removal of M. giganteus. It is subject to commercial take under nationally approved management plans. Total population size on Barrow Island is estimated at 1,800 individuals.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There appear to be no major threats to this species overall. The Barrow Island population has recently been found to suffer from anaemia and poor condition and this may be related to nutritional stress (S. D. Bradshaw pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

There are not thought to be any major threats to the common wallaroo (1) (4), and the steep, rocky areas it favours help to protect this species to some degree (4) (10). In addition, like many other large kangaroo species, the common wallaroo may have benefitted from artificial water holes provided for livestock, as well as a reduction in dingo numbers and the presence of sheep, creating favourable grazing conditions (2) (9) (10) (11). Although the common wallaroo is legally culled in some areas for food, skins, and because of alleged damage to pastures and crops (2) (7) (10) (11), it is estimated to make up only about three percent of the overall commercial kangaroo quota (4). However, there is some controversy over how many kangaroos can be safely harvested, particularly in light of increasing human habitat modification and drought (2). The Barrow Island wallaroo, M. r. isabellinus, may be more vulnerable than the mainland subspecies, particularly in light of its smaller, isolated population, estimated to number only around 1,800 individuals (4) (7). This distinctive subspecies is listed as Vulnerable under the Environmental Protection and Biodiversity Conservation Act 1999 (EPBC), with threats including inappropriate fire regimes, introduced species, road fatalities, and habitat degradation associated with the development of oilfields (3) (5). The population has also recently been found to suffer from anaemia and poor condition, possibly related to nutritional stress (1) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Mainland populations are present in a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The mainland populations of the common wallaroo are widespread and abundant, and are present in a number of protected areas (1). Commercial take is regulated under nationally approved management plans (1) (7), which aim to maintain populations of common wallaroo in an ecologically sustainable manner (10) (12) (13). Barrow Island is also protected as a nature reserve (3) (4). Conservation priorities for the vulnerable Barrow Island wallaroo include determining the extent of nutritional stress in the population, continuing with long-term population monitoring, and determining if oil field management can be modified to improve the condition of the wallaroo population. It will also be important to prevent introductions of non-native species, to monitor and improve traffic management to reduce road fatalities, to develop an appropriate fire management strategy, and to restore land impacted by the oil field (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Wallaroos are vwell adapted to arid environments. Aside from their behavioral adaptations, wallaroos are interesting to scientists because of their physiological adaptations. Wallaroos have a very efficient excretory system that recycles nitrogen and urea to make a very concentrated urine. This physiological adaptation can provide scientists with much information about evolution of physiological characteristics. Tyndale-Biscoe, 1973; Warneke, 1995.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common wallaroo

The common wallaroo (Macropus robustus) or wallaroo, also known as euro or hill wallaroo[2] is a species of macropod ( Kangaroo). Particularly one subspecies (M. r. erubescens) is commonly called euro.[3]

The eastern wallaroo is mostly nocturnal and solitary, and is one of the more common macropods. It makes a loud hissing noise and some subspecies are sexually dimorphic, like most wallaroos.[4]

Contents

Subspecies

There are four subspecies of the wallaroo:[1]

  • Eastern wallaroo (M. r. robustus)[3] – Found in eastern Australia, males of this subspecies have dark fur, almost resembling the black wallaroo (Macropus bernardus). Females are lighter, being almost sandy in colour.[4]
  • Euro (M. r. erubescens) – [5] Found on covering most of its remaining range, this subspecies is variable, but mostly brownish in colour.[4]
  • M. r. isabellinus – This subspecies is restricted to Barrow Island in Western Australia, and is comparatively small. It is uniformly reddish brown.[4]
  • M. r. woodwardi – This subspecies is found in the Kimberley region of Western Australia and in a band running through Northern Territory. It is the palest subspecies and is a dull brown-grey colour.[4]

The eastern wallaroo (Macropus robustus robustus)—which is grey in colour—occupies the eastern slopes of the Great Dividing Range and the euro (Macropus robustus erubescens)—rufous in colour—occupies land westward.

Status

The eastern wallaroo as a species is not considered to be threatened, but the Barrow Island subspecies (M. r. isabellinus) is classified as vulnerable.[2]

References

  1. ^ a b Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 65. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3. 
  2. ^ a b c Ellis, M., Menkhorst, P., van Weenen, J., Burbidge, A., Copley, P., Denny, M., Woinarski, J., Mawson, P. & Morris, K. (2008). Macropus robustus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ a b WE Poole and JC Merchant (1987): Reproduction in Captive Wallaroos - the Eastern Wallaroo, Macropus-Robustus-Robustus, the Euro, Macropus-Robustus-Erubescens and the Antilopine Wallaroo, Macropus-Antilopinus. Australian Wildlife Research 14(3) 225 - 242. online link
  4. ^ a b c d e Menkhorst, Peter (2001). A Field Guide to the Mammals of Australia. Oxford University Press. p. 118. 
  5. ^ TF Clancy and DB Croft (1992): Population dynamics of the common wallaroo (Macropus robustus erubescens) in arid New South Wales. Wildlife Research 19(1) 1 - 15. online link
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!