Molecular Biology and Genetics

Molecular Biology

Barcode data: Hasarius adansoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTGCGCCAGATATAGCGTTTCCTCGAATGAATAATTTGAGTTTTTGATTGTTGCCTCCTTCTTTGATATTATTATTTATTAGATCTATGGCTGAAATAGGAGTAGGGGCGGGATGAACTGTTTATCCTCCTTTGGCTTCTGTTGTTGGACATGCCGGAAGTAGTGTTGATTTTGCTATTTTTTCTTTACATTTAGCGGGTGCTTCTTCTATTATAGGGGCTATTAATTTTATTTCTACAGTAATTAATATACGTTCTGTGGGAATATCTATAGATAGGGTTCCTTTATTTGTGTGATCTGTTTTAATTACTGCTGTGCTATTATTGTTATCTTTACCTGTTTTAGCGGGAGCTATTACTATATTGTTGACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCTGGGGGAGGTGATCCTATTTTATTTCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTATATATTTTGATTTTACCAGGATTTGGGATTGTTTCTCATGTGATTAGAGTTTCAGTAGGGAAGCGTGAACCTTTTGGATCGTTAGGGATAATTTATGCTATGGTTGGAATTGGAGGTATAGGATTTGTAGTATGGGCTCATCATATATTTTCTGTGGGTATAGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hasarius adansoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hasarius adansoni

Hasarius adansoni, also called Adanson's House Jumper, is a species of jumping spider common and associated with people in most of the warmer parts of the world. It is one of better described species of jumping spider in the world, having been described originally as Attus adansonii by Audouin in 1826, then redescribed in officially recognised literature another 86 times by 2012, often placed in other genera. The first placement into Hasarius was made by the French arachnologist Eugène Simon in 1871.[1]

Contents

Distribution

H. adansoni is found in warmer climates around the world, for example Japan, Taiwan and Australia. It has also been introduced worldwide in greenhouses and similar places, for example in several German zoos. In China it is distributed in the provinces of Gansu, Guangxi, Guangzhou and Yunnan.

Appearance

female

Females grow up to 8mm, males up to 6mm.

The males are mostly black, with a red "mask" and pedipalps that are partly white. A white crescent is present on the back part of the abdomen, and another one on the front part of the opisthosoma. There are two small white dots on the posterior back, and two even smaller ones towards the end. These white areas - especially on the pedipalps - have a nacre-like iridescence.

Females are dark brown, with a lighter and somewhat rufous opisthosoma.

Habits

male H. adansoni retreat

These spiders build a silken retreat at night, which is are about twice the length of the animal. Although the same retreat is sometimes reused, others are built in the vicinity.

Male individuals have been seen to feed on immature females, although this may be by accident.

Name

The species is named after the French naturalist Michel Adanson.

References

  1. ^ The World Spider Catalog, V13.0 by N. I. Platnick © 2000 — 2012 AMNH
  • Audouin, V. (1826). Explication sommaire des planches d'arachnides de l'Egypte et de la Syrie publiées ... in "Description de l'Egypte...". Histoire Naturelle 1(4):1-339 (arachnids, pp. 99–186).
  • Patoleta, B. & Zabka, M. (1999). Salticidae (Arachnida, Araneae) of Islands off Australia PDF
  • Peng, X-J. & Li, S. (2004). The Jumping Spiders from Dali, Yunnan, China (Araneae:Salticidae). The Raffles Bulletin of Zoology 52(2):413-417. PDF
  • Duffey, E. (1964). The Terrestrial Ecology of Ascension Island. The Journal of Applied Ecology 1(2):219-251. PDF
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!