Ecology

Habitat

Depth range based on 18 specimens in 4 taxa.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 1400 - 5825
  Temperature range (°C): 1.536 - 1.598
  Nitrate (umol/L): 36.420 - 37.110
  Salinity (PPS): 34.678 - 34.691
  Oxygen (ml/l): 3.451 - 3.727
  Phosphate (umol/l): 2.581 - 2.586
  Silicate (umol/l): 146.513 - 162.958

Graphical representation

Depth range (m): 1400 - 5825

Temperature range (°C): 1.536 - 1.598

Nitrate (umol/L): 36.420 - 37.110

Salinity (PPS): 34.678 - 34.691

Oxygen (ml/l): 3.451 - 3.727

Phosphate (umol/l): 2.581 - 2.586

Silicate (umol/l): 146.513 - 162.958
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calyptogena n.sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTGCTGGCGTTTTAGGTGAT---AGCCATTTGTACCAGGTAGTGGTGACTGCTCATGGGTTGTTAATAATTTTCTTTTTAGTAATACCTATGATAATTGGGGGGTTTGGTAATTGGTTAGTACCTTTAATGTTGCAGATTCCTGATATAGCTTTCCCACGGATGAATAATTTAAGATTTTGGTTGATACCTAGGTCAGTTTTAATGCTGCTTGGTTCTGCTTATGTAAAAAGTGGGGCGGGTACTGGGTGAACTATTTACCCCCCGTTATCTAAAATTATAGGGCATGCTGGTCCTTCTGTGGATTTTGTGATTTTGTCTTTACATTTAGGTGGGGTGTCTTCTATTTTGGCTTCTATTAATTTTGTAGTTACTTCTCTTTGCATGCGTGTTGAGGCTTTATCTTTGTTACGTGTAACTATGTTTGTTTGATGTGTTGCTGTCACTGGTTTTTTGTTAATTATTGCTATACCTGTTTTAGCTGGGAGATTGACAATGTTATTAACTGATCGTAAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calyptogena n.sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!