Overview

Comprehensive Description

The life habit of the adult is epibiotic on bare basalt and other hard substrates (e.g. tubes of vestimentiferans) associated with deep-sea hydrothermal vents. The presence of this species is correlated with elevated levels of hydrogen sulfide. Endemic to vents. Protoconch 0.4 mm in length, indicative of a planktotrophic larval stage with a high dispersal capability. Paired ctenidia consist of inner and outer demibranchs, each with descending and ascending lamellae. The gills contain sulphur- oxidizing chemoautotrophic symbionts. A commensal polychaete (Branchipolynoe symmytilida) is frequently found within the mantle cavity of the mussel.
  • BELKIN S., NELSON D.C. & H.W. JANNASCH (1986) Biol. Bull. 170: 110-121.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Galapagos Spreading Center, East Pacific Rise: 13°N to 22°S. At the Pacific-Antarctic Ridge (31°S and 38°S) another species of Bathymodiolus was collected in 2005 (R. von Cosel & R. Vrijenhoek, unpublished data).
  • BELKIN S., NELSON D.C. & H.W. JANNASCH (1986) Biol. Bull. 170: 110-121.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Shell smooth, modioliform, with subterminal umbones; periostracum present and straw-yellow to brown in colour; external surface lacks sculpture and is dull white beneath periostracum; hinge edentulous; ligament opisthodetic, paricincular, strong, extending most of the length of the dorsal margin; well developed byssus. Valvular siphonal membrane long and stretching towards ventrally; on anterior part fusion of inner mantle fold reaching ventrally to 1/3 shell length, together with siphonal membrane leaving rather short byssus opening in the middle.
  • BELKIN S., NELSON D.C. & H.W. JANNASCH (1986) Biol. Bull. 170: 110-121.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Shell length up to 18.4 cm.
  • BELKIN S., NELSON D.C. & H.W. JANNASCH (1986) Biol. Bull. 170: 110-121.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size :
  Size under dissecting microscope: 400-450µm
  Size under compound microscope:  400-450µm

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Morphology

  Bathymodiolus thermophilus have planktotrophic larvae. We find them in our plankton samples when they are close to settling. It is possible that we do not collect them as trochophores or D-stage larvae because they may be too small to be caught on our 63µm sieves. Near to settlement they are brownish in color.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Bathymodiolus thermophilus Kenk & Wilson, 1985
Catalog Number: USNM 803661
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Near Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Hydrothermal vents, "mussel bed"
Depth (m): 2478 to 2478
Vessel: Alvin DSR/V
  • Holotype: Kenk, V. & Wilson, B. R. 1985. Malacologia. 26(1-2): 253-271.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Can be confused with:

Bathymodiolus thermophilus is similar in color to juvenile Bathypecten, but is much smaller (< 450 µm vs. >1mm) and not scallop-shaped.     

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 60 specimens in 1 taxon.
Water temperature and chemistry ranges based on 59 samples.

Environmental ranges
  Depth range (m): 837 - 2643
  Temperature range (°C): 1.822 - 9.211
  Nitrate (umol/L): 18.361 - 41.112
  Salinity (PPS): 34.668 - 35.419
  Oxygen (ml/l): 2.461 - 4.413
  Phosphate (umol/l): 1.114 - 2.814
  Silicate (umol/l): 10.356 - 160.712

Graphical representation

Depth range (m): 837 - 2643

Temperature range (°C): 1.822 - 9.211

Nitrate (umol/L): 18.361 - 41.112

Salinity (PPS): 34.668 - 35.419

Oxygen (ml/l): 2.461 - 4.413

Phosphate (umol/l): 1.114 - 2.814

Silicate (umol/l): 10.356 - 160.712
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bathymodiolus thermophilus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 32
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Bathymodiolus thermophilus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 32 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGATATTGGAACTTTATATATTTTATTAGGTTTGTGGTCTGGAATAATTGGAACAAGATTAAGGATACTTATTCGTATTGAATTAGCACGTCCTGGAAGGTTTTTGGGGGAT---GATCAGCTTTATAATGTTATTGTAACTGCTCATGCTTTAGTTATGATTTTTTTTATAGTTATACCATTAATAGTAGGAGGCTTCGGAAATTGGTTGCTGCCTTTAATAATAGGTTCAATTGACATAATCTTCCCTCGTTTAAATAATTTAAGGTTTTGGTTCTTACCTGCATCTTTATTTACTTTACTATTATCTACATTTATTGAGAGCGGGGCCGGAACTGGGTGAACTTTATACCCGCCCCTATCTTCTTATACTGGGCATAGGGGCCCAGCCGTTGATATATCTCTATTTTCGCTTCATTTAGCAGGTGCTTCTTCTATTGGTGGATCAATTAATTTTCTTACTAGTATAAAAAATATATCTGTTGAAAGTATGCGAGGAGAGCGAATAGTCCTATTTGTCTGATCTATGGCTGTAACAGCAGTTTTATTACTGGTTTCTCTGCCTGTACTGGCGGGAGGTATTACTATGTTGATTTTTGATCGTCATTTTAATACATCTTTTTATGATCCTAGAGGTGGAGGAGATCCTGTTTTATACCAACATTTATTTTGATTTTTTGGTCACCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bathymodiolus thermophilus

Bathymodiolus thermophilus is a species of large, deep water mussel, a marine bivalve mollusc in the family Mytilidae, the true mussels. The species was discovered at abyssal depths when submersible vehicles such as DSV Alvin began exploring the deep ocean. It occurs on the sea bed, often in great numbers, close to hydrothermal vents where hot, sulphur-rich water wells up through the floor of the Pacific Ocean.

Description[edit]

Bathymodiolus thermophilus is a very large mussel with a dark brown periostracum, growing to a length of about 20 cm (8 in). It is attached to rocks on the seabed by byssus threads but it is able to detach itself and move to a different location. It is sometimes very abundant, having been recorded at densities of up to 300 individuals per square metre (270 per square yard).[2]

Distribution[edit]

Bathymodiolus thermophilus is found clustered around deep sea thermal vents on the East Pacific Rise between 13°N and 22°S and in the nearby Galapagos Rift at depths around 2800 metres (one and a half miles).[2][3]

Biology[edit]

Bathymodiolus thermophilus has chemosymbiotic bacteria in its gills which oxidise hydrogen sulfide. The mussel absorbs nutrients synthesized by these bacteria and is not reliant on photosynthetically produced organic matter.[3] However it also feeds by extracting suspended food particles from the surrounding water through its gills. Mostly these are the bacteria that live around the vent, often forming a dense mat.[2] When some mussels were transplanted from a sulphur-rich vent to another site lacking sulphur compounds, the symbiont bacteria died and the mussels suffered gill deterioration and loss of condition. This led researchers to believe that the mussels would be unable to survive when the flow of sulphur-rich water from their ephemeral vents runs out.[4]

The larvae of Bathymodiolus thermophilus drift with the currents and are planktotrophic, feeding on phytoplankton and small zooplankton. This method of feeding is likely to give them good dispersal capabilities and it has been shown by DNA analysis that there is a high rate of gene flow between populations round different vents.[3]

References[edit]

  1. ^ Huber, Markus (2010). "Bathymodiolus thermophilus Kenk & Wilson, 1985". World Register of Marine Species. Retrieved 2012-04-15. 
  2. ^ a b c Hydrothermal vents Deep Ocean. Retrieved 2012-04-15.
  3. ^ a b c Deep-Sea Vent Mussels Monterey Bay Aquarium Research Institute. Retrieved 2012-04-15.
  4. ^ Raulfs, E. C.; Macko, S. A.; van Dover, C. L. (2004). "Tissue and symbiont condition of mussels (Bathymodiolus thermophilus) exposed to varying levels of hydrothermal activity". Journal of the Marine Biological Association of the UK 84: 229–234. doi:10.1017/S0025315404009087h. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!