Molecular Biology and Genetics

Molecular Biology

Barcode data: Roboastra luteolineata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTGTATGTCTTTTTAGGTATATGGTGTGGTTTAGTCGGTACCGGGTTGAGTTTACTGATTCGTTTTGAATTAGGGACTGCTGGTGCATTTTTAGGGGAT---GATCACTTTTATAATGTGATTGTAACTGCCCATGCTTTTGTAATAATTTTTTTTATAGTTATGCCTTTAATAATTGGGGGTTTCGGGAATTGAATGGTTCCTTTACTAATTGGAGCGCCGGATATAAGTTTTCCTCGAATAAATAATATAAGTTTTTGGTTACTTCCTCCTTCATTTATTTTATTATTATGTTCAACTTTGATAGAAGGAGGAGCTGGAACTGGATGGACTGTTTATCCCCCATTGTCTGGTCCTGTGGCTCATGGAGGGGCTTCTGTAGATTTGGCTATTTTCTCTCTTCATTTGGCGGGGGCTTCTTCACTTTTAGGAGCAATTAATTTTATTACTACTATTTTTAATATACGGTCTTCTGCTATAACTTTGGAGCGGTTGAGTCTTTTTGTTTGATCTGTATTGGTAACAGCTTTTCTTTTACTTTTATCTTTACCTGTCTTAGCGGGGGCTATTACTATGCTATTGACTGATCGAAATTTTAATACTAGTTTTTTTGATCCAGCGGGAGGGGGTGATCCGATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Roboastra luteolineata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Roboastra luteolineata

Roboastra luteolineata is a species of sea slug, a polycerid nudibranch, a marine gastropod mollusc in the family Polyceridae.

Contents

Distribution

This species occurs in the tropical Indo-Pacific Ocean. It has been observed as far north as Japan in the Northern Hemisphere and as far south as the Poor Knights Islands in New Zealand in the Southern Hemisphere. This species is sometimes confused with the nudibranch Tambja affinis due to its outwardly similar appearance.[1]

Description

Roboastra luteolineata is quite large in comparison to most other sea-slugs. It is black, with yellow lines running lengthwise down the body. It can be distinguished from other similar-looking nudibranchs by the light green patches on the top of the head between its rhinophores. It is a fast-moving species.

Ecology

Roboastra luteolineata, like other species in the genus Roboastra, feeds on other nudibranchs, actively hunting them out. The species seems to generally feed only on nudibranchs from the family Polyceridae and has been observed eating Tambja morosa, Tambja verconis and Nembrotha kubaryana. It is also cannibalistic and will eat smaller individuals of its own species.[2]

References

  1. ^ a b [1] Sea Slug Forum, accessed 14 December 2009.
  2. ^ [2] Sea Slug Forum Messages, accessed 14 December 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!