Overview

Comprehensive Description

Limacina helicina antarctica is a traditionally recognized subspecies of the shelled pteropod mollusk Limacina helicina, a key organism in polar pelagic ecosystems, where it can can account for 50% of total zooplankton abundance (number of individuals per unit volume). Pteropods are strictly pelagic mollusks that are highly adapted to life in the open ocean. They are commonly referred to as ‘‘sea butterflies’’ due to their wing-like parapodia, which are evolutionary modifications of the gastropod foot. Pteropods produce large mucus webs to filter-feed on phytoplankton as well as small zooplankton (including their own juveniles). Species of the Order Thecosomata, including L. helicina (the only thecosome pteropod in Arctic waters), produce a fragile external calcium carbonate (aragonite) shell. Shelled pteropods play a significant geochemical role in the oceans, as they contribute to the export of calcium carbonate and can represent a major component of the carbon transport to the deep ocean. The likely effects of ocean acidification (resulting from the absorption of increasing quantities of CO2 from the atmosphere) have been studied in a variety of shell-building marine organisms, including L. helicina, which may be especially vulnerable as a result of its aragonite shell and its distribution in polar oceans, which acidify especially quickly due to their particular chemical and physical characteristics. (Comeau et al. 2010 and references therein; Hunt et al. 2010)

Although L. helicina was formerly believed to have a bipolar distribution, further investigation has shown that the Arctic and Antarctic forms are genetically distinct species. Traditionally, northern and southern hemisphere forms were recognized as subspecies and referred to as L. h. helicina and L. h. antarctica, respectively. Three morphotypes, or "forma", of the subspecies L. h. helicina have often been recognized (acuta, helicina, and pacifica) along with two morphotypes of L. h. antarctica (antarctica and rangi). However, genetic studies have revealed that L. h. helicina and L. h. antarctica differ by around 34% in mitochondrial COI sequence, far more divergence than would be seen intraspecifically. Sequence data are not yet available to help clarify the taxonomic status of the various morphotypes, which may or may not actually be genetically distinct. (Hunt et al. 2010)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limacina helicina antarctica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGTATCTATATTTCTAAGCGGTCAATTTTATAACGTCTTAGTCACAAACCATGCATTAATTATAATTTTCTTCTTTATTATACCATTAGTAATTGGGGGATTTGGGAATTGAATAATCCCTCTTTACCTGAATATCAGGGATATGATTTTTCCACGTATAAACAATTTTAGGTTTTGATTACTACCAAATTCTTTTATATTATTGATATTAAGTTCACTAATGAGGATAGGTGCAGGATTAGGATGAACTATGTATCCACCATTAAGTTCAA---TTGGTCATAATACATTAAGAGTGGATTTCGCAATCTTTAGACTACATATAGCAGGATTAAGTTCTATCATTGGAGCTATTAATATAATCACTACTATTACTCTAAGGCGATGCACTAGAATGAGATGAAGACGAATACCTCTCTACCTATGAAGAATAATCATTACTCTTTATTTGTTACTCCTTAGCCTTCCTGTTTTAGCCGGGGGTATTACAATACTACTAATAGATCGGAATTTCAATACAACATTCTTTGATCCAGTGGGAGGAGGAGATCCAATCTTGTTTCAGCATTTATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Limacina helicina antarctica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at State Herbarium of South Australia
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Limacina antarctica

Limacina antarctica is a species of swimming sea snail in the family Limacinidae,[2] which belong to the group commonly known as sea butterflies (Thecosomata).

Limacina antarctica is a keystone species of the mesozooplankton of Antarctic pelagic ecosystems.[3]

Until 2010 this taxon was known only as Limacina helicina antarctica or as Limacina helicina f. antarctica. Limacina antarctica is however now considered to be a separate species from Limacina helicina, based on cytochrome c oxidase subunit I (COI) gene sequences.[4]

Distribution[edit]

The distribution of Limacina antarctica is circumglobal south of 50°S.[5]

This species occurs in the Weddell Sea[6] and Ross Sea in the Antarctic[7] and in Cumberland Bay, South Georgia.[8] and other localities in the Southern Ocean.

Description[edit]

Limacina antarctica has a sinistral and very thin shell.[3] Its thickness is approximately 2–9 μm.[3] There are ribs on the surface of the shell.[3] There are differences in the shell structure between Limacina antarctica and Limacina helicina.[3]

The width of the shell is 0.5-6 mm.[3]

Apertural view.
Umbilical view.

Ecology[edit]

Limacina antarctica is a holoplanktonic species. It is very abundant in the Southern Ocean, with up to 2681 individuals per m3.[9] This species is abundant in the Ross Sea, Antarctica.[10] It is sometimes even more abundant than krill.[10][11]

Limacina antarctica feeds mainly on phytoplankton and also on zooplankton, but less so.[10] It catches its prey using mucus webs.[10]

This snail is a primary consumer and directly depends on phytoplankton.[10] When the phytoplankton is reduced, the population of Limacina antarctica is also reduced,[10] and it can even disappear as happened in McMurdo Sound in the summer of 2000-2001.[10] It is considered an indicator species of the health of the ecosystem.[10] Under different conditions in McMurdo Sound there can be over 300 individuals per m3, which is over 20% of the biomass of zooplankton.[10]

Fecal pellets of Limacina antarctica and its quantity have been firstly described by Manno et al. (2010).[12] Fecal pellets are oval, greenish brown and with peritrophic membrane.[12] A size of a single pellet varies from 103 μm (286600 μm3) to 120 μm (440,610 μm3).[12] A single Limacina antarctica produces about 6-11 pellets daily.[12] Population of Limacina antarctica in the studied area in the Ross Sea produced from about 71,000 pellets per square meter per year to about 362,000 pellets per square meter per year.[12] Fecal pellets of Limacina antarctica has contributed to about 19% of flux of organic carbon.[12] Fecal pellets of Limacina antarctica together with dead Limacina antarctica can cover up to 72% (estimation) of organic carbon flux to the deep water.[12]

Limacina antarctica probably affect carbon cycle, resources of phytoplankton and dimethyl sulfide (emission by phytoplankton), that may have impact on the Earth's climate.[10]

Many[10] predators depend on Limacina antarctica as their food source:

The myctophid fish Ceratoscopelus warmingii is one of numerous fish species that prey on Limacina antarctica

References[edit]

  1. ^ Woodward S. P. (1854). A manual of the Mollusca; or, A rudimentary treatise of recent and fossil shells. 2: 207. London. Plate 14, figure 41.
  2. ^ WoRMS (2010). Limacina antarctica Woodward, 1854. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=509607 on 2011-01-29
  3. ^ a b c d e f Sato-Okoshi, W.; Okoshi, K.; Sasaki, H.; Akiha, F. (2010). "Shell structure of two polar pelagic molluscs, Arctic Limacina helicina and Antarctic Limacina helicina antarctica forma antarctica". Polar Biology 33 (11): 1577. doi:10.1007/s00300-010-0849-1. 
  4. ^ Hunt, B.; Strugnell, J.; Bednarsek, N.; Linse, K.; Nelson, R. J.; Pakhomov, E.; Seibel, B.; Steinke, D.; Würzberg, L. (2010). "Poles Apart: The "Bipolar" Pteropod Species Limacina helicina is Genetically Distinct Between the Arctic and Antarctic Oceans". In Finkel, Zoe. PLoS ONE 5 (3): e9835. doi:10.1371/journal.pone.0009835. PMC 2847597. PMID 20360985. 
  5. ^ "Limacina helicina antarctica antarctica". Marine Species Identification Portal, accessed 9 February 2011.
  6. ^ Linse, K.; Brandt, A.; Hilbig, B.; Wegener, G. (2004). "Composition and distribution of suprabenthic fauna in the south-eastern Weddell Sea and off King George Island". Antarctic Science 14. doi:10.1017/S0954102002000512. 
  7. ^ Accornero, A.; Manno, C.; Esposito, F.; Gambi, M. C. (2003). "The vertical flux of particulate matter in the polynya of Terra Nova Bay. Part II. Biological components". Antarctic Science 15 (2): 175. doi:10.1017/S0954102003001214.  PDF.
  8. ^ Ward, P. (2004). "The distribution of zooplankton in an Antarctic fjord at South Georgia during summer and winter". Antarctic Science 1 (2). doi:10.1017/S0954102089000210. 
  9. ^ Comeau, S.; Gorsky, G.; Jeffree, R.; Teyssié, J. -L.; Gattuso, J. -P. (2009). "Impact of ocean acidification on a key Arctic pelagic mollusc (Limacina helicina)". Biogeosciences 6 (9): 1877. doi:10.5194/bg-6-1877-2009. 
  10. ^ a b c d e f g h i j k l m n o p Seibel, B. A.; Dierssen, H. M. (2003). "Cascading trophic impacts of reduced biomass in the Ross Sea, Antarctica: Just the tip of the iceberg?". The Biological bulletin 205 (2): 93–97. PMID 14583506. 
  11. ^ Orr, J. C.; Fabry, V. J.; Aumont, O.; Bopp, L.; Doney, S. C.; Feely, R. A.; Gnanadesikan, A.; Gruber, N.; Ishida, A.; Joos, F.; Key, R. M.; Lindsay, K.; Maier-Reimer, E.; Matear, R.; Monfray, P.; Mouchet, A.; Najjar, R. G.; Plattner, G. K.; Rodgers, K. B.; Sabine, C. L.; Sarmiento, J. L.; Schlitzer, R.; Slater, R. D.; Totterdell, I. J.; Weirig, M. F.; Yamanaka, Y.; Yool, A. (2005). "Anthropogenic ocean acidification over the twenty-first century and its impact on calcifying organisms". Nature 437 (7059): 681–686. doi:10.1038/nature04095. PMID 16193043.  PDF. (author's draft).
  12. ^ a b c d e f g Manno, C.; Tirelli, V.; Accornero, A.; Fonda Umani, S. (2009). "Importance of the contribution of Limacina helicina faecal pellets to the carbon pump in Terra Nova Bay (Antarctica)". Journal of Plankton Research 32 (2): 145. doi:10.1093/plankt/fbp108. 
  13. ^ k., W.; d., K.; j., H. (2001). "Mycosporine-like amino acids (MAAs) in phytoplankton, a herbivorous pteropod ( Limacina helicina ), and its pteropod predator ( Clione antarctica ) in McMurdo Bay, Antarctica". Marine Biology 139 (5): 1013. doi:10.1007/s002270100654. 
  14. ^ a b Larson, R. J.; Harbison, G. R. (1990). "Medusae from Mcmurdo Sound, Ross Sea including the descriptions of two new species, Leuckartiara brownei and Benthocodon hyalinus". Polar Biology 11. doi:10.1007/BF00236517. 
  15. ^ Pakhomov E. A., Perissinotto R. & McQuaid C. D. (1996). "Prey composition and daily rations of myctophid fishes in the Southern Ocean". Marine Ecology Progress Series 134: 1-14. PDF.
  16. ^ Mesa, M. L.; Vacchi, M.; Zunini Sertorio, T. (2000). "Feeding plasticity of Trematomus newnesi (Pisces, Nototheniidae) in Terra Nova Bay, Ross Sea, in relation to environmental conditions". Polar Biology 23: 38. doi:10.1007/s003000050006. 
  17. ^ Foster, B. A.; Montgomery, J. C. (1993). "Planktivory in benthic nototheniid fish in McMurdo Sound, Antarctica". Environmental Biology of Fishes 36 (3): 313. doi:10.1007/BF00001727. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!