Overview

Brief Summary

Tegenaria agrestis, known in the United States as the Hobo Spider, is native to Europe but is now well established in the Pacific Northwest of the United States and spreading eastward (Baird and Stoltz 2002). Hobo Spiders are medium-sized brown spiders that build funnel webs and resemble many other agelinid spiders. Beginning in the late 1980s, the claim was made that this spider was responsible for necrotic skin lesions seen in the Pacific Northwest that had previously been attributed (without justification) to the Brown Recluse (Loxosceles reclusa) (Vest 1987a,b; Vest et al. 1996), although the Brown Recluse (the bites of which can indeed produce necrotic skin lesions) is absent from or extremely rare in the Pacific Northwest (Vetter 2008). Although Brown Recluses clearly cannot be responsible for the symptoms in question in this region, the claim that Hobo Spider bites are instead responsible has been seriously challenged (Binford 2001; Vetter and Isbister 2004, 2008; Gaver-Wainwright et al. 2011), although this question may not yet be fully resolved. Many serious conditions having nothing to do with spiders can produce necrotic skin lesions. For example, methicillin-resistant Staphylococcus aureus (MRSA) bacterial infections are a potentially very serious cause of skin and soft tissue injury and are often presented by patients as spider bites. Suchard (2011) found that the great majority of patients seeking medical attention for a "spider bite" were actually suffering from skin and soft-tissue infections. Misdiagnosis as "spider bite" can lead to delayed or inappropriate treatment (Vetter and Isbister 2008).

The Hobo Spider is one of two European agelinid spiders that became established in the Pacific Northwest of the United States early in the 20th century. The first of the two aliens to be noted, the Giant House Spider (T. duellica) has been considered harmless in both its native range and in North America. In Europe, the Hobo Spider, like the Giant House Spider, has been considered medically benign and, as noted above, recent investigations have suggested that despite repeated assertions that Hobo Spiders in North America are not so benign, it now appears likely that in fact North American Hobo Spiders are generally as harmless as those from European populations. Both the Hobo Spider and Giant House Spider have expanded their ranges and occur together in some areas, although the Giant House Spider is still mainly restricted to the Pacific Northwest west of the Cascades (Vetter et al. 2003).

  • Baird, C.R. and R.L. Stoltz. 2002. Range expansion of the Hobo Spider, Tegenaria agrestis, in the northwestern United States (Araneae, Agelinidae). The Journal of Arachnology 30: 201-204.
  • Binford, G.J. 2001. An analysis of geographic and intersexual chemical variation in venoms of the spider Tegenaria agrestis (Agelenidae). Toxicon 39: 955-968.
  • Gaver-Wainwright, M.M., R.S. Zack, M.J. Foradori, and L.C. Lavine. 2011. Misdiagnosis of Spider Bites: Bacterial Associates, Mechanical Pathogen Transfer, and Hemolytic Potential of Venom from the Hobo Spider, Tegenaria agrestis (Araneae: Agelenidae). Journal of Medical Entomology 48(2): 382-388.
  • Suchard, J.R. 2011. "Spider bite" lesions are usually diagnosed as skin and soft-tissue infections. The Journal of Emergency Medicine 41(5): 473-481.
  • Vest, D.K. 1987a. The linking of Tegenaria agrestis spiders to necrotic arachnidism in Idaho, Oregon, and Washington. Toxicon 25(2): 156-157.
  • Vest, D.K. 1987b. Necrotic arachnidism in the northwest United States and its probable relationship to Tegenaria agrestis (Walckenaer) spiders. Toxicon 25: 175-84.
  • Vest, D.K., W.E. Keene, and M. Heumann. 1996. Necrotic arachnidism—Pacific Northwest 1988–1996. Journal of the American Medical Association 275: 1870-1871.
  • Vetter, R.S. 2008. Spiders of the genus Loxosceles (Araneae, Sicariidae): a review of biological, medical and psychological aspects regarding envenomations. Journal of Arachnology, 36(1): 150-163.
  • Vetter, R.S. and G.K. Isbister. 2004. Do hobo spider bites cause dermonecrotic injuries? Annals of Emergency Medicine 44: 605-607.
  • Vetter, R.S. and G.K. Isbister. 2008. Medical Aspects of Spider Bites. Annual Review of Entomology 53: 409-29.
  • Vetter, R.S., A.H. Roe, R.G. Bennett, C.R. Baird, L.A. Royce, W. T. Lanier, A.L. Antonelli, and P.E. Cushing. 2003. Distribution of the Medically-implicated Hobo Spider (Araneae: Agelenidae) and a Benign Congener, Tegenaria duellica, in the United States and Canada. Journal of Medical Entomology, 40(2):159-164.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tegenaria agrestis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTGTATTTGGTATTTGGGGCTTGGTCTGCTATAGTTGGAACAGCTATAAGAGTTCTTATTCGAATTGAGTTAGGTCAACCTGGTAGATTTTTGGGTGATGATCATTTATATAATGTTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATGATTGGTGGGTTTGGTAATTGATTAGTTCCTTTAATATTGGGAGCTCCAGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTGTTACCGCCTTCTTTGATTATATTGTTTATTTCTTCTATAGTTGAGATAGGTGTTGGGGCTGGGTGAACTATTTATCCTCCTTTAGCTTCTTCTATTGGTCATTTTGGTAGATCTGTTGATTTTGCTATTTTTTCTTTGCATTTGGCTGGGGCTTCTTCTATTATAGGTGCTATTAATTTTATTTCTACTATTTTTAATATACGATCTGTTAGAATAACTATAGAGAAGGTTCCTTTATTTGTATGATCTGTTTTAATTACTGCTGTTTTGTTATTATTGTCTTTACCTGTATTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCTGGGGGAGGAGATCCTATTTTATTTCAGCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tegenaria agrestis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hobo spider

The hobo spider (Tegenaria agrestis) is a member of the genus of spiders known colloquially as funnel web spiders, but not to be confused with the Australian funnel-web spider. It is one of a small number of spiders whose bites are generally considered to be medically significant. Individuals construct a funnel-shaped structure of silk sheeting and lie in wait at the small end of the funnel for prey insects to blunder onto their webs. Hobo spiders sometimes build their webs in or around human habitations. This species of spider has a reputation for aggressiveness, due to its poor eyesight. They will normally avoid contact with humans unless accidentally crushed or squeezed. The spider's venom is strong enough to cause considerable local pain and, possibly, necrosis.[1]

Contents

Habitat and History [edit]

Europe [edit]

The hobo spider is a resident of fields, rarely entering human habitations due to the presence of major competitors, particularly the giant house spider (Tegenaria duellica) which is a common resident of houses and other man-made structures in Europe. As a result human contacts with the hobo spider are uncommon in Europe. The species was first described in 1802 by naturalist C.A. Walkenaer,[2] under the name Aranea agrestis, in reference to its western European habitat in fields, woods, and under rocks.

North America [edit]

Tegenaria agrestis is a non-native species in the United States, where it was introduced to the Pacific Northwest from Western Europe. It is believed to have first appeared in the port city of Seattle sometime before the 1930s.[3] There is speculation that it arrived as eggs in commercial agricultural shipments from Europe, since isolated adults in shipments would have had difficulty in establishing a breeding population. It was first reported in the U.S. in 1936 by arachnologist Harriet Exline (as Tegenaria magnacava).[4] There, without the widespread presence of any dominant competitors, it rapidly adapted to living in urban areas, where it became abundant and extended its range. By 1968 it had become established as far east as Spokane, Washington, and Moscow, Idaho, and as far south as Roseburg, Oregon.[5] They have recently been discovered as far north as Vancouver Island, Canada.[6] Hobo spiders have also been found in other western states, such as Utah, where they are commonly found inside of homes.[7]

(Two other closely related spiders live in Washington state, the giant house spider (Tegenaria duellica, or alternatively Tegenaria gigantea) and the barn funnel weaving spider or domestic house spider (Tegenaria domestica). All three of these spiders originated in Europe.[3])

Identification [edit]

Spiders, including the hobo spider, vary considerably in appearance, and identification can be difficult. Identification relies on an examination of the spider’s anatomy. Positive identification requires microscopic examination of the epigynum and palps and is best done by an Arachnologist. However, the following characteristics can help in identification of hobo spiders in order to prevent misidentification and eradication of beneficial species with a similar general appearance:

  • Hobo spiders lack the colored bands found on many spiders of the Agelenidae family where the leg joints meet.[8]
  • The abdomen has chevron (V-shaped) patterns (possibly many of them) down the middle, with the chevrons pointing towards the head.
  • Hobo spiders have a light stripe running down the middle of the sternum. If the spider instead has three or four pairs of light spots on the lateral portions of the sternum, then it is one of the other two related Tegenaria species. However absence of spots is not conclusive proof that the spider is a hobo spider, since the spots on other Tegenaria species may be extremely faint and not readily visible.[8]
  • Hobo spiders do not have two distinct longitudinal dark stripes on the top side of the cephalothorax, instead showing indistinct or diffused patterns. Washington spiders with distinct dark stripes include spiders from the genera Agelenopsis and Hololena and possibly some wolf spiders. (These spiders do not have common names.)[8]

Toxicity and aggression [edit]

The toxicity and aggression of the hobo spider are currently disputed by arachnologists. One common name, the aggressive house spider may arise from a misinterpretation of the Latin name agrestis, (lit. "of the fields") as "aggressive". If a hobo spider is tending an egg sac, it may become aggressive if it perceives the egg sac as being threatened.[9] However, they generally do not bite unless forced to protect themselves.

In the United States, the hobo spider has been considered to be a dangerous species based on a toxicology study on rabbits where lesions appeared after spiders were induced to bite the rabbits.[10] This laboratory study has led to the proposal that in some parts of the U.S. nearly all bites attributed to the brown recluse spider are in reality the hobo spider's bite.[11] The CDC and other U.S. government agencies[12] have also used this same study as the basis for a report claiming that the hobo spider bite causes necrosis in humans,[1] despite the absence of any confirmed cases. Subsequent attempts to replicate the study by injecting sufficient venom to ensure envenomation have failed to produce necrotic lesions, and there is even question as to whether the lesions observed in the original study were necrotic.[13]

In Canada, there are scientists who claim that no hobo spider bites lead to dermal necrosis.[14] Hobo spiders are common in Europe, though bites are relatively unknown, and there are no confirmed reports of them causing necrosis despite hundreds of years of coexistence there. The only documented case of a verified hobo spider bite leading to necrotic skin lesions involves a person who had a pre-existing medical condition (phlebitis) that can also cause the appearance of skin lesions.[13]

Hobo spider bites are not known to be fatal to healthy humans. The necrosis in purported cases is similar to, but milder than, that caused by the brown recluse spider, and in severe cases can take months to heal. Other reported symptoms include intense headaches, vision abnormalities, and/or general feelings of malaise. These symptoms are not confirmed for the hobo spider bite specifically due to lack of positive identification of the spider by an expert, and the Oregon Poison Center (affiliated with the Oregon Health & Science University) is attempting to gather definitive evidence regarding the validity of these reports as of September 2007.[15][16]

Notes [edit]

  1. ^ a b [1] Centers for Disease Control and Prevention (CDC). Necrotic arachnidism-Pacific Northwest, 1988-1996. MMWR Morb Mortal Wkly Rep 1996;45:433-6.
  2. ^ Faune Parisienne, vol. 2, p. 187
  3. ^ a b http://www.bulkmsm.com/research/spider/Australia/page7.htm#2
  4. ^ Psyche, vol. 43(1), pp. 21–26), cited in http://www.fs.fed.us/r6/uma/ims/hobo.pdf
  5. ^ hobospider.org
  6. ^ http://www.youtube.com/watch?v=krYYw0PLcak
  7. ^ http://utahpests.usu.edu/uppdl/htm/hobo-spiders
  8. ^ a b c http://pep.wsu.edu/pdf/pls116_1.pdf
  9. ^ http://www.washington.edu/burkemuseum/spidermyth/myths/hobo.html
  10. ^ Vest, D. K. (1987). Envenomation by Tegenaria agrestis (Walckenaer) spiders in rabbits. Toxicon 25(2):221-4.
  11. ^ Vest, D. K. (1987). Necrotic arachnidism in the northwest United States and its probable relationship to Tegenaria agrestis (Walckenaer) spiders. Toxicon 25(2):175-84.
  12. ^ Hobo Spider
  13. ^ a b Vetter, R. S. and G. K. Isbister. (2004). Do hobo spider bites cause dermonecrotic injuries? Annals of Emergency Medicine 44:605-607.
  14. ^ Bennett, R. G. and R. S. Vetter. (2004). An approach to spider bites: erroneous attribution of dermonecrotic lesions to brown recluse and hobo spider bites in Canada. Canadian Fam. Physician 50: 1098-1101.
  15. ^ Peter Korn (2007-09-21). "Spider bite? Drop the critter in the mail". Portland Tribune. Retrieved 2007-11-02. 
  16. ^ "OHSU Wants Your Spiders, Dead or Alive". Oregon Health & Science University. 2007-09-05. Retrieved 2007-11-02. 

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!