Overview

Distribution

Range Description

This species is endemic to Lake Malawi.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in soft sediment (silt, sand, fine gravel) in Lake Malawi.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melanoides magnifica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTCGTGCTGAACTAGGTCAACCAGGTGCCTTATTAGGAGAC---GATCAACTTTATAATGTAATTGTAACGGCCCATGCTTTTGTAATAATTTTCTTTCTAGTTATACCAATGATGATTGGTGGTTTTGGAAACTGATTAGTTCCGCTGATATTAGGTGCTCCAGACATAGCTTTCCCACGATTAAATAATATAAGTTTCTGACTTCTTCCACCTGCCTTACTATTACTTCTCTCTTCTGCAGCTGTTGAAAGTGGTGTGGGAACGGGTTGAACTGTTTATCCCCCTTTAGCAAGGAATTTGGCTCACGCTGGTGGTTCGGTGGACCTTGCTATTTTTTCTTTACATCTAGCGGGCGTTTCGTCTATTTTAGGAGCTGTAAACTTTATTACAACTATTATTAACATACGATGACGAGGTATGCAGTTTGAACGATTACCTTTATTTGTTTGATCAGTAAAAATTACAGCTATTCTTTTATTGCTTTCGTTACCTGTCTTAGCTGGTGCTATCACTATACTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melanoides magnifica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Kaunda, E., Magombo, Z., Kahwa, D. & Mailosa, A.

Reviewer/s
Seddon, M.B. & Kristensen, T. (Mollusc Red List Authority)

Contributor/s

Justification
There is insufficient information on population status, distribution, threats and ecology to make a Red List assessment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Population densities provided in Genner and Michel (2003) for mixed Malawi Melanoides give a max of 1370 individuals/m2, also in Louda et al. (1983) at 123 individuals/m2 at Cape Maclear, shallow water.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!