Overview

Distribution

The fishing spider can be found in East Texas, the coastal New England states, and south along the Atlantic coastline to Florida, and as far west as North Dakota and Texas. This spider can also be found in the moist environments of Central America and South America.

(Jackman 1997)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Large and boldly marked, the fishing spider closely resembles the wolf spider, although it has eight eyes equal in size, three tarsal claws, and it lacks a cribellum, which is a spinning organ found just in front of the spinners. Coloring is grey to brown with light areas and light spots on its brown abdomen. On average, length is 17-26mm for females, and 9-13mm for males. The length for females can sometimes exceed 30mm.

(Jackman 1997, Preston-Mafham and Preston-Mafham 1996)

Range mass: 1.0 to 1.5 g.

Average mass: 1.0 g.

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Dolomedes triton can be found primarily around lakeside vegetation, boat docks and other structures near a body of water.

(Jackman 1997)

Terrestrial Biomes: forest ; rainforest ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In order to capture its prey, the fishing spider makes use of concentric surface waves on still water to pinpoint the exact location of the prey, up to 18cm away. Once it homes in on this locale, it dives beneath the water, as deep as 18cm below the surface, to capture the prey. Fishing spiders feed on insect larvae, tadpoles, and small fish, eating up to five times its own weight in one day.

(Ewing 1989, Prestono-Mafham and Preston-Mafham 1993)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Males must court females carefully, as they may be eaten if the female is sufficiently hungry and/or the male fails to successfully communicate.

After mating and fertilization, females spin a silk sack to carry their eggs in, and carry them around in their front jaws until just before the eggs hatch. At this time, the female will place the eggsac between leaves in a shelter made especially for this occasion. The female fishing spider then guards her eggs until after they have hatched, and then guards the young fishing spiders until they are ready to move away on their own, usually about a week after they have hatched.

(Jackman 1997)

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Legs 'row' across water: fishing spider
 

The legs of the fishing spider enable it to 'row' across the surface of water using the horizontal propulsive forces generated by the drag of the legs and their associated 'dimples.'

     
  "What happens is that the leg and dimple (the latter from the downward weight transferred by the leg) act as a unit. Both move rearward as the animal pushes, and the rearward drag of the unit generates the forward thrust (fig. 5.8b). (Moving a dimple backwards forces water to move forwards, hence this nonobject has perfect ordinary drag.)" (Vogel 2003:108)


"Fishing spiders live throughout the United States, although they're particularly abundant in the South. They lurk along the edges of ponds and streams, and when insects drop to the water, these spiders rush across the surface to attack. They can also dip their legs underwater and grab swimming tadpoles and small fish.

The first order of business for animals with this lifestyle is to stay on top of the water. Fishing spiders do so by taking advantage of surface tension. Water molecules are more attracted to one another than they are to molecules in the air. This molecular pull makes the surface of water act like a sheet of rubber. When a spider sets a leg on the water, a dimplelike depression forms around it, and the water pushes back up to regain a smooth surface

Although surface tension can keep fishing spiders afloat, it makes it hard for them to go anywhere. On land they can push their legs against solid ground, generating an opposing force that carries them forward. Their waxy legs can't get a purchase on the surface of the pond, however; the water is, in effect, too slippery to permit the spiders to move.
 

But move they do, and for the past few years Robert Suter, a biologist at Vassar College, has been studying just how they do it. What he has found is that the spiders row across the water's surface by using the dimples their legs make in it. When a fishing spider moves one of its legs from front to back, it draws that dimple back with it. As the dimple moves, it acts like an oar, pushing against the surrounding water and creating a force that propels the spider forward.

 A fishing spider rows with the middle two of its four pairs of legs. First it swings back its third pair, then the second pair, and when both pairs are extended as far back as they can go, the spider raises them from the water and brings them forward again. Meanwhile, it keeps its front and rear pairs of legs motionless, using their surface tension to keep itself afloat while it prepares for the next stroke

There's a limit to how fast fishing spiders can travel this way, however. To speed up, a spider can either make deeper dimples (giving itself bigger oars) or push them back faster." (Zimmer 2000)

Watch Video
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
  • Zimmer, C. 2000. Walking on Water - the fishing spider. Natural History. 109(3): 30-31.
  • Suter, RB. 1999. Cheap transport for fishing spiders (Araneae, Pisauridae): the physics of sailing on the water surface. Journal of Arachnology. 27(2): 489-496.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dolomedes triton

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GACTTTATATTTTATATTTGGGGTGTGATCTGCTATAGTGGGAACAGCTATAAGAGTATTAATTCGAATAGAATTAGGGAATTCTGGAAGACTTTTAGGTGATGATCATTTATATAATGTAATAGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATGGTAATACCAATTTTAATTGGTGGTTTTGGTAATTGATTGGTTCCTTTAATGTTAGGTGCTCCTGATATATCATTTCCTCGAATGAATAATTTGTCTTTTTGATTATTACCTCCTTCTTTATTTTTATTATTTATATCATCTATAGTGGAAATAGGGGTAGGAGCAGGGTGAACTGTTTATCCTCCTTTATCTTCTAGAGTTGGACATATAGGAAGATCTATGGATTTTGCCATTTTTTCTTTACATTTAGCTGGGGCTTCTTCTATTATAGGGGCAGTTAATTTTATTTCTACAATTATTAATATACGTTTAGTAGGAATAACTATAGAAAAGGTTCCTTTGTTTGTATGATCTGTTTTTATTACAGCTATTTTATTATTATTATCTTTACCAGTATTAGCTGGTGCTATTACTATATTATTAACAGATCGAAATTTTAATACTTCTTTTTTTGATCCAGCAGGAGGTGGGGATCCTATTTTGTTTCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dolomedes triton

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

These spiders are not given any special conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The fishing spider, like all species of spiders, is important in keeping the insect population of the world under control.

(Jackman 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Six-spotted fishing spider

The six-spotted fishing spider, Dolomedes triton, is an arachnid from the nursery web spider family Pisauridae. This species is from the genus Dolomedes, the fishing spiders. This species of fishing spider is named after the mythological Greek god Triton who is the messenger of the big sea and the son of Poseidon.[1] These spiders can be seen scampering along the water’s surface when a person walks by in which they are often referred to as dock spiders because they are often witnessed as they quickly vanish through the cracks of a boat dock.

Description[edit]

This spider can be identified by its large size and distinctive markings. They have eight eyes with good vision and the body is grey to brown. They have a white to a pale cream colored stripe running down each side of the cephalothorax. The abdomen has many light colored spots and also has light colored lines running down the sides of the abdomen. When this species is seen from below, there are six dark spots present on the bottom of the cephalothorax in which the common name is derived.[1] Like many spiders, this species shows sexual dimorphism.[2] The female is larger than the male. The female is about 60 millimetres (2.4 in) long including the legs; her body length is 15–20 mm (0.59–0.79 in) and the male's body is 9–13 mm (0.35–0.51 in) long.[3] The juvenile spiders look similar to adults but are smaller and they go through a series of molts within their lifetime to grow and reach adult size.

A bird's eye view showing the markings on the body

Distribution and habitat[edit]

These spiders are native to the Western Hemisphere and can be found throughout the contiguous United States and southern Canada, more common east of the Rocky Mountains and Great Plains. They can also be found in Central America and South America.[4] They are semi-aquatic and live in wetland habitats such as ponds, lake shores, and they can also inhabit slow-moving streams. They can be found among vegetation, rocks and other structures near the water such as boat docks.[4] They often dive underwater and grab onto a plant when frightened.

Behavior and diet[edit]

This species is diurnal which hunts during the day as it waits patiently for hours until depending on whether it is stimulated by prey. They are often seen with their legs sprawled out by the water while they are waiting for prey. These spiders eat other invertebrates, tadpoles and occasionally small fish. They hunt by the water’s surface in which they can walk on water and dive under up to 18 cm (7.1 in) to capture prey. Their good vision contributes to their success when diving to capture prey.[4] They capture underwater prey as well as prey that fall on the water's surface or travels on water such as water striders.

Feeding on an amphipod, showing chelicerae and pedipalp movement

Reproduction[edit]

Egg production can happen anytime between June to September and sometimes in April but this is not often.[3] Breeding takes place when the male does his courtship ritual. This can be the end of the male's life because cannibalism does occur.[5] After mating, the spherical egg sac is then produced. Before hatching, the female builds a "nursery web" over vegetation and guards it.[6] The egg sac is placed among the leaves to help keep it concealed. After the offspring have hatched, they sit under her protection in the web until they are ready to disperse into the outside world. The offspring leave the web about a week after they hatch.[4]

References[edit]

  1. ^ a b Species Dolomedes triton – Sixspotted Fishing Spider, BugGuide
  2. ^ Sixspotted Fishing Spider
  3. ^ a b Sixspotted Fishing Spider
  4. ^ a b c d Dolomedes triton, Animal Diversity Web
  5. ^ J. Chadwick Johnson (2005). "The role of body size in mating interactions of the sexually cannibalistic fishing spider Dolomedes triton". Ethology 111 (1): 51–61. doi:10.1111/j.1439-0310.2004.01042.x. 
  6. ^ Six-spotted Fishing Spider – Dolomedes triton
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!