Molecular Biology and Genetics

Molecular Biology

Barcode data: Argiope bruennichi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTGCGATGATTATATTCAACTAACCATAAGGATATTGGAACTTTATACTTGATTTTTGGAGCTTGAGCTGCTATAGTGGGTACAGCAATAAGAGTATTGATTCGAATTGAATTAGGACAGCCTGGGAGATTTATGGGTGAT---GATCAATTATATAATGTAATTGTTACAGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCAATCTTGATTGGGGGTTTTGGGAACTGGTTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATGAATAATTTAAGGTTTTGGTTATTACCTCCTTCATTATTTCTTTTAATTGTTTCTTCAATAGTAGAAATAGGAGTAGGAGCAGGATGAACAGTGTATCCCCCATTGGCTGGATTAGAAGGTCATGCTGGGAGATCCGTAGATTTTGCAATTTTTTCACTTCATTTGGCTGGGGCTTCTTCAATTATAGGAGCAATTAATTTTATTTCAACAATTATTAATATGCGATTTTATGGAATAACAATAGAAAAGGTACCTTTATTTGTTTGGTCTGTTTTAATTACGGCTGTTCTTTTATTATTATCTTTACCTGTTTTAGCAGGGGCTATTACAATATTATTAACTGATCGAAATTTTAATACTTCTTTTTTTGATCCTTCAGGGGGTGGGGATCCTATTTTATTTCAGCATTTATTTTGATTTTTTGGTCATCCCGAAGTTTATATTTTAATTTTACCAGGATTTGGGATTGTATCTCACATTATTAGATCTTCTGTTGGTAAGCGGGAGCCTTTTGGTAATTTAGGGATAATTTATGCTATAGTAGGAATTGGTGGAATAGGTTTTGTTGTGTGAGCTCATCACATATTTTCTGTAGGAATAGATGTTGATACCCGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Argiope bruennichi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Argiope bruennichi

Several eggsacks
Female spider guarding eggsack

The wasp spider (Argiope bruennichi) is a species of orb-web spider distributed throughout central Europe, Northern Europe, north Africa and parts of Asia. Like many other members of the genus Argiope, (including St Andrew's Cross spiders), it shows striking yellow and black markings on its abdomen.

The spider builds a spiral orb web at dawn or dusk, commonly in long grass a little above ground level, taking it approximately an hour. The prominent zigzag shape called the stabilimentum, or web decoration, featured at the centre of the orb is of uncertain function, though it may be to attract insects.

When a prey item is first caught in the web, Argiope bruennichi will quickly immobilise its prey by wrapping it in silk. The prey is then bitten and then injected with a paralysing venom and a protein dissolving enzyme.

The male of the species is much smaller than the female. It can often be seen in or near a female's web waiting for her to complete her final moult, at which time she reaches sexual maturity. At this time her chelicerae (jaws) will be soft for a short time and the male may mate with the female without the danger of being eaten.

During Summer 2006, research was carried out in the UK to find that there has been an influx of these spiders to the UK. The colour is still similar, although the yellow stripes are a bit more cream coloured.[1]

In 2008 Aidan Grady, Christie van Tinteren and Matthew Secombe were responsible for the discovery of well over 100 of these spiders. The colony was later discovered to be the largest ever found in the UK. The team worked with Plymouth University and the RSPB to catalogue the discovery and learn more about the spiders. Sir David Attenborough said that the discovery was remarkable.

This species of spider was featured in the movie Eight Legged Freaks as the main species antagonists.

There is one subspecies currently recognized:

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!