Articles on this page are available in 1 other language: German (1) (learn more)

Overview

Comprehensive Description

Diplostyla concolor (Wider, 1834)

Materials

Type status: Other material. Occurrence: sex: 1 female; Location: locationID: 3; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: Santana; locality: Faja da Nogueira - Pte. Roquete ; verbatimElevation: 1074; decimalLatitude: 32.7391 ; decimalLongitude: -16.9156 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Type status: Other material. Occurrence: sex: 2 females; Location: locationID: 16; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: Santana; locality: Pico do Areeiro ; verbatimElevation: 1594; decimalLatitude: 32.7287 ; decimalLongitude: -16.9202 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Type status: Other material. Occurrence: sex: 1 female; Location: locationID: 18; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: Porto Moniz; locality: Chao da Ribeira ; verbatimElevation: 491; decimalLatitude: 32.7957 ; decimalLongitude: -17.1117 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Type status: Other material. Occurrence: sex: 1 female; Location: locationID: 20; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: São Vicente; locality: Encumeada ; verbatimElevation: 999; decimalLatitude: 32.7558 ; decimalLongitude: -17.0143 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Ecological interactions

Native status

introduced

Distribution

Holarctic

  • Crespo, Luis C., Boieiro, Mario, Cardoso, Pedro, Aguiar, Carlos A. S., Amorim, Isabel R., Barrinha, Carla, Borges, Paulo A. V., Menezes, Dilia, Pereira, Fernando, Rego, Carla, Ribeiro, Servio, Silva, Israel F., Serrano, Artur R. M. (2014): Spatial distribution of Madeira Island Laurisilva endemic spiders (Arachnida: Araneae). Biodiversity Data Journal 2, 1051: 1051-1051, URL:http://dx.doi.org/10.3897/BDJ.2.e1051
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

concolorDiplostylaLinyphiidaeAnimalia

Diplostyla concolor (Wider, 1834)

Materials

Type status: Other material Occurrence: recordedBy: Kostanjšek , RTŠB 2011 ; sex: 1 female; Location: locationID: SI02; country: Slovenia ; locality: Hrastovec ; minimumElevationInMeters: 270; maximumElevationInMeters: 270; decimalLatitude: 46.5613 ; decimalLongitude: 15.7953 ; Event: eventDate: 2011-07-22 ; habitat: forest

  • Candek, Klemen, Gregoric, Matjaz, Kostanjsek, Rok, Frick, Holger, Kropf, Christian, Kuntner, Matjaz, Miller, Jeremy A., Hoeksema, Bert W. (2013): Targeting a portion of central European spider diversity for permanent preservation. Biodiversity Data Journal 1, 980: 980-980, URL:http://dx.doi.org/10.3897/BDJ.1.e980
Public Domain

Hoeksema, Bert W.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Diplostyla concolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 72
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Diplostyla concolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTAATTTTTGGGGCTTGATCTGCTATAGTGGGAACGGCTATAAGAGTATTAATTCGAATTGAGTTAGGTCAAACAGGTAGAATATTAGGAGATGATCATTTATATAATGTTATTGTTACGGCGCATGCGTTTGTTATAATTTTTTTTATAGTTATACCTATTTTGATTGGGGGATTTGGAAATTGGTTAGTTCCTTTAATATTAGGGGCTCCTGATATAGCTTTTCCTCGAATGAATAATTTAAGTTTTTGACTTCTTCCTCCTTCTCTTTTTATACTATTTGTATCTTCTATAGTTGAGATAGGTGTAGGGGCTGGATGAACAGTTTACCCTCCTTTGGCTTCTTTAGAGGGGCACTCGGGAAGTGCTGTAGATTTTGCTATTTTTTCTTTGCATTTAGCAGGAGCTTCATCTATTATAGGAGCTATTAATTTTATTTCAACTATTTTAAATATGCGTTCTTATGAAATAAGTATAGAAAAAGTTTCGCTTTTTGTGTGATCTGTGTTAATTACTGCGGTTTTGTTACTTTTGTCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGGAATTTTAATACTTCTTTCTTTGATCCGGCAGGTGGAGGGGATCCAGTTCTTTTTCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!