Articles on this page are available in 1 other language: German (1) (learn more)

Overview

Comprehensive Description

concolorDiplostylaLinyphiidaeAnimalia

Diplostyla concolor (Wider, 1834)

Materials

Type status: Other material Occurrence: recordedBy: Kostanjšek , RTŠB 2011 ; sex: 1 female; Location: locationID: SI02; country: Slovenia ; locality: Hrastovec ; minimumElevationInMeters: 270; maximumElevationInMeters: 270; decimalLatitude: 46.5613 ; decimalLongitude: 15.7953 ; Event: eventDate: 2011-07-22 ; habitat: forest

Public Domain

Hoeksema, Bert W.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diplostyla concolor (Wider, 1834)

Materials

Type status: Other material. Occurrence: sex: 1 female; Location: locationID: 3; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: Santana; locality: Faja da Nogueira - Pte. Roquete ; verbatimElevation: 1074; decimalLatitude: 32.7391 ; decimalLongitude: -16.9156 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Type status: Other material. Occurrence: sex: 2 females; Location: locationID: 16; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: Santana; locality: Pico do Areeiro ; verbatimElevation: 1594; decimalLatitude: 32.7287 ; decimalLongitude: -16.9202 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Type status: Other material. Occurrence: sex: 1 female; Location: locationID: 18; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: Porto Moniz; locality: Chao da Ribeira ; verbatimElevation: 491; decimalLatitude: 32.7957 ; decimalLongitude: -17.1117 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Type status: Other material. Occurrence: sex: 1 female; Location: locationID: 20; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: São Vicente; locality: Encumeada ; verbatimElevation: 999; decimalLatitude: 32.7558 ; decimalLongitude: -17.0143 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Ecological interactions

Native status

introduced

Distribution

Holarctic

Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diplostyla concolor (Wider, 1834)

Materials

Type status: Other material. Occurrence: sex: 1 female; Location: locationID: 3; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: Santana; locality: Faja da Nogueira - Pte. Roquete ; verbatimElevation: 1074; decimalLatitude: 32.7391 ; decimalLongitude: -16.9156 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Type status: Other material. Occurrence: sex: 2 females; Location: locationID: 16; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: Santana; locality: Pico do Areeiro ; verbatimElevation: 1594; decimalLatitude: 32.7287 ; decimalLongitude: -16.9202 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Type status: Other material. Occurrence: sex: 1 female; Location: locationID: 18; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: Porto Moniz; locality: Chao da Ribeira ; verbatimElevation: 491; decimalLatitude: 32.7957 ; decimalLongitude: -17.1117 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Type status: Other material. Occurrence: sex: 1 female; Location: locationID: 20; higherGeography: Macaronesia; continent: Europe; waterBody: Atlantic Ocean; islandGroup: Madeira archipelago; island: Madeira; country: Portugal ; countryCode: PT; stateProvince: Madeira; county: São Vicente; locality: Encumeada ; verbatimElevation: 999; decimalLatitude: 32.7558 ; decimalLongitude: -17.0143 ; geodeticDatum: WGS84; Event: samplingProtocol: Pitfall

Ecological interactions

Native status

introduced

Distribution

Holarctic

Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

concolorDiplostylaLinyphiidaeAnimalia

Diplostyla concolor (Wider, 1834)

Materials

Type status: Other material Occurrence: recordedBy: Kostanjšek , RTŠB 2011 ; sex: 1 female; Location: locationID: SI02; country: Slovenia ; locality: Hrastovec ; minimumElevationInMeters: 270; maximumElevationInMeters: 270; decimalLatitude: 46.5613 ; decimalLongitude: 15.7953 ; Event: eventDate: 2011-07-22 ; habitat: forest

Public Domain

Hoeksema, Bert W.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diplostyla concolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTAATTTTTGGGGCTTGATCTGCTATAGTGGGAACGGCTATAAGAGTATTAATTCGAATTGAGTTAGGTCAAACAGGTAGAATATTAGGAGATGATCATTTATATAATGTTATTGTTACGGCGCATGCGTTTGTTATAATTTTTTTTATAGTTATACCTATTTTGATTGGGGGATTTGGAAATTGGTTAGTTCCTTTAATATTAGGGGCTCCTGATATAGCTTTTCCTCGAATGAATAATTTAAGTTTTTGACTTCTTCCTCCTTCTCTTTTTATACTATTTGTATCTTCTATAGTTGAGATAGGTGTAGGGGCTGGATGAACAGTTTACCCTCCTTTGGCTTCTTTAGAGGGGCACTCGGGAAGTGCTGTAGATTTTGCTATTTTTTCTTTGCATTTAGCAGGAGCTTCATCTATTATAGGAGCTATTAATTTTATTTCAACTATTTTAAATATGCGTTCTTATGAAATAAGTATAGAAAAAGTTTCGCTTTTTGTGTGATCTGTGTTAATTACTGCGGTTTTGTTACTTTTGTCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGGAATTTTAATACTTCTTTCTTTGATCCGGCAGGTGGAGGGGATCCAGTTCTTTTTCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Diplostyla concolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 72
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!