Overview

Distribution

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Steatoda grossa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CGAATAAATAATTTGAGATTCTGATTGTTACCACCTTCCCTACTCCTGTTATTTATCTCTTCTATGGAGGAAATAGGAGTAGGGGCTGGTTGAACTATTTACCCCCCTTTGTCCTCGTTAGAAGGACACAGAGGAAGATCTGTAGATTTT---GCAATTTTTTCGTTACATTTGGCCGGGGCTTCTTCTATTATAGGAGCTATCAATTTTATTTCAACTATTTTAAATATACGAATAGTTGGGATAAAAATGGAAAAATTAAGATTGTTTGTGTGATCAGTTTTGATTACAGCTGTGCTCTTATTACTTTCGTTACCTGTTTTAGCAGGG---GCTATTACAATACTATTAACCGATCGGAATTTTAATACTACTTTTTTCGACCCTGCTGGGGGGGGAGATCCTATC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Steatoda grossa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Steatoda grossa

Steatoda grossa, commonly known as the cupboard spider, the dark comb-footed spider, the brown house spider (in Australia), or the false black widow (though several other species are known by these names), is a common species of spider in the genus Steatoda.

It is a cosmopolitan species found in many parts of the world, including North America, Australasia, and Europe. As one of this spider's common name indicates, the spider superficially resembles, and is frequently confused for, the black widow and other venomous spiders in the genus Latrodectus.

Description[edit]

Like black widows, the female S. grossa is 6-10.5 mm in length, and dark colored, with a round, bulbous abdomen. Typical coloration ranges from purplish-brown to black, with light-colored markings. Unlike black widows, redbacks, and other Latrodectus species, S. grossa does not have a bright red hourglass pattern or any other bright markings. Like many spiders, the male is sometimes smaller; But can many times be nearly as long as the females. It measures 4.1-10.0mm in length, and is thinner than the female. The two sexes are colored similarly, however the sexually mature male almost always has lighter, more reddish coloured legs than the female. Individual S. grossa may shed up to six times (instars) before reaching maturity. They can go several months without feeding, provided they have access to water. A well fed female can lay 3 or more egg sacs each year, in which each egg sac typically contains between 40 - 100 eggs. The mother can often be observed watching her eggs for hours, even days at a time once the eggs start changing color and grow close to hatching. At normal household temp/humidity, an egg will usually hatch within a month of being laid. The spiderlings are independent from time of hatch.

Female S. grossa spiders can live up to six years; the typical lifespan for the male is 1-1.5 years. Males often die shortly after mating.

Habitat and range[edit]

As is common with other members of the family Theridiidae, S. grossa constructs a cobweb, i.e., an irregular tangle of sticky silken fibers. As with other web-weavers, these spiders have very poor eyesight and depend mostly on vibrations reaching them through their webs to orient themselves to prey or warn them of larger animals that could pose a danger. They are not aggressive, and most injuries to humans are due to defensive bites delivered when a spider gets unintentionally squeezed or pinched. It is possible that some bites may result when a spider mistakes a finger thrust into its web for its normal prey, but ordinarily intrusion by any large creature will cause these spiders to flee.

S. grossa is a cosmopolitan species, and is found in many parts of the world, including all three coasts in North America, in Australia and New Zealand, and in Europe.

A related species, commonly found in North America, is Steatoda borealis. This spider is similar to S. grossa in shape, but slightly smaller, and is generally found in colder climates. This spider can be identified by colored markings on the dorsal side of its abdomen, rather than on the ventral side.

Medical significance[edit]

The bite of S. grossa is known to be medically significant in humans, but minor, without any long-lasting effects. Symptoms of bites include blistering at the site of the bite, and/or a general malaise lasting for several days. Latrodectus antivenom has been shown to be effective at treating bites from Steatoda grossa, after it was mistakenly administered to a S. grossa bite victim who was erroneously believed to have been bitten by the far more dangerous redback.[1]

In popular culture[edit]

A specimen of S. grossa (painted with nontoxic blue and red stripes and "wrangled" by Steven R. Kutcher, "The Spider-Man Behind Spider-Man") used as the spider which bit Peter Parker in the Sam Raimi-directed Spider-Man film, released in 2002.[2]

Footnotes[edit]

  1. ^ Graudins A, Gunja N, Broady KW, Nicholson GM (June 2002). "Clinical and in vitro evidence for the efficacy of Australian red-back spider (Latrodectus hasselti) antivenom in the treatment of envenomation by a Cupboard spider (Steatoda grossa)". Toxicon 40 (6): 767–75. doi:10.1016/S0041-0101(01)00280-X. PMID 12175614. 
  2. ^ http://www.findarticles.com/p/articles/mi_m0BFU/is_5_88/ai_93919434 Star bugs: Steven Kutcher, Hollywood's top bug wrangler, trained the real spiders in Spider-Man

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!