Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loxosceles rufescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTGATTAGTTCCTTTAATG---TTGGGAGCTCCTGATATGGCTTTCCCGCGGATGAATAATTTAAGATTTTGATTGCTTCCTCCTTCTTTAATGTTATTAAGTCTTTCGTCTGTTAGAGATAGAGGGGTGGGGGCGGGTTGGACTTTATACCCTCCTTTGTCAGATAATCAGGCTCATTTTGGTATTTCTGTGGATATA---GCTATTTTCTCTCTTCACTTGGCGGGGGCTTCTTCAATTATGGGGGCTATTAATTTTATTACTACTATTGTCAATATACGAAGAGAAGGGATAAGATTTGAGAGGGTTCCTTTATTTGTTTGGTCTGTGTTAGTAACGGCCGTATTATTGTTATTATCTTTACCTGTTTTGGCGGGG---GCTATTACTATATTGTTAACGGATCGTAACTTTAACACATCCTTTTTTGATCCTGCTGGTGGAGGGGACCCTATTTTGTTTCAACATTTATTTTGATTTTTTGGTCATCCTGAGGTTTATATTTTAATTTTACCGGGTTTTGGTATTATCTCTCATGTTATTAGTTATAGTGTAGGGAAGCGT---GAGCCTTTTGGTTCAATTGGGATGATTTATGCGATAGTGGGGATTGGTTTGATAGGTTTTGTTGTATGAGCCCATCATATGTTTTCTGTGGGGATAGACGTTGATACTCGAGCGTACTTTACAGCTGCCACAATAATTATTGCGGTGCCAACAGGCATTAAGGTTTTTAGTTGAATG---GCTACTTTACATGGGGCT---TATTTTTCTTTGAGAGCTCCTCTGCTTTGGTGTTTTGGATTTGTTTATTTATTTACGTTGGGGGGGATCACAGGTGTGATCTTGGCTAATTCTTCATTGGATATCGTGTTACATGACTCTTATTACGTAGTAGCTCATTTTCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loxosceles rufescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mediterranean recluse spider

Loxosceles rufescens, the Mediterranean recluse spider, originated in the Mediterranean region as its name implies, but has been introduced to Arkansas, Hawaii,[1] and the gulf states of the United States. Although uncommon, there are more confirmed reports of Loxosceles rufescens than the brown recluse in Ohio.[citation needed] It, too, is a human-associated species with similar habits and probably similar venom risks.[citation needed]

References [edit]

  1. ^ Kuwaye, Todd T. "Case Based Pediatrics for Medical Students and Residents". Retrieved 2006-12-10. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!