Overview

Brief Summary

Biology

Receptive females will allow a male to mate, usually during the rainy season, resulting in the making of an egg sac and the laying of 300 to 500 eggs several weeks later (4). The egg sac is incubated for about seven to eight weeks at 24 to 27 degrees Celsius, after which pale-coloured young emerge and cluster together. The spiderlings develop quickly, moulting again over the next couple of weeks, by which time they disperse to live independent lives. Unreceptive females are likely to be aggressive towards approaching males and may try to kill and eat them (2) (4). Primarily a nocturnal, opportunistic ambusher, the curlyhair tarantula preys on insects and small vertebrates. An area on the end of each leg is sensitive to smell, taste and vibration, and is used to detect prey. The tarantula holds its prey with its pedipalps (front limbs) and injects it with venom delivered via two hollow fangs. This venom has a double purpose, paralysing the prey, as well as beginning digestion. Once the venom has acted the tarantula is able to suck up the proteins and fats of its prey, leaving just a small ball of undigested body parts (2) (4). This usually docile tarantula will kick hairs off the abdomen with its hind legs when threatened, which cause blindness if they hit the eyes of a predator and can also cause a rash on the skin (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The curlyhair tarantula is a plump-bodied spider, covered with dark brown to black hair. It has a golden-bronze sheen due to longer gold hairs that cover the whole body, which are particularly dense on the hind legs (3). Males are often a lighter bronze colour than females (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The range of the curlyhair tarantula stretches along the Atlantic side of Honduras, Nicaragua and north-eastern Costa Rica (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

A burrowing species, the curlyhair tarantula is found in tropical rainforest regions, either around the base of large trees, near rivers, or in patches of cleared rainforest (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brachypelma albopilosum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTTCCTCGTATGAATAATTTAAGTTTTTGGTTGTTGCCTCCTTCTTTATTTTTGTTGGTTTTATCATCATTAACTGATGTAGGGGTGGGGGCGGGATGAACTATTTATCCTCCTTTGTCTTCTTTTGTTGGTCATTCTGGTGGTGGAATGGATTTT---GCCATTTTTTCTTTACATTTAGCTGGAGCTTCTTCAATTATGGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Brachypelma albopilosum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

The curlyhair tarantula is listed on Appendix II of CITES (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The largest threat to the curlyhair tarantula is now habitat loss (4). Once captured in large numbers for the international pet trade, the curlyhair tarantula is now bred in captivity worldwide and relatively few are caught in the wild (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), the curlyhair tarantula can now only be traded internationally according to quotas and with trade permits (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brachypelma albopilosum

Brachypelma albopilosum is a species of tarantula known commonly as the Honduran curlyhair or simply Curlyhair tarantula. Its native range includes Central America, from Honduras to Costa Rica . They are terrestrial, opportunistic burrowing spiders. This tarantula is covered in long hairs that have a characteristic curl to them giving them a unique look.

Description[edit]

The Curlyhair tarantula is a plump-bodied spider, covered with dark brown to black hair. It has a golden-bronze sheen due to longer gold hairs that cover the whole body, which are particularly dense on the hind legs.[1] Males are often a lighter bronze color than females.[2]

Range and Habitat[edit]

The range of the Curlyhair tarantula stretches along the Atlantic side of Honduras, Nicaragua and north-eastern Costa Rica. A burrowing species, the curlyhair tarantula is found in tropical scrubland, either around the base of large trees, near rivers, or in patches of cleared rain forest.[2][3]

Biology[edit]

Receptive females will allow a male to mate, usually during the rainy season, resulting in the making of an egg sac and the laying of 300 to 500 eggs several weeks later.[3] The egg sac is incubated for about seven to eight weeks at 24 to 27 degrees Celsius, after which pale-colored young emerge and cluster together. The spiderlings develop quickly, molting again over the next couple of weeks, by which time they disperse to live independent lives. Unreceptive females are likely to be aggressive towards approaching males and may try to kill and eat them.[2][3]

Primarily a nocturnal, opportunistic ambusher, the curlyhair tarantula preys on insects and small vertebrates. An area on the end of each leg is sensitive to smell, taste and vibration, and is used to detect prey. The tarantula holds its prey with its pedipalps (front limbs) and injects it with venom delivered via two hollow fangs. This venom has a double purpose, paralysing the prey, as well as beginning digestion.Once the venom has acted the tarantula is able to suck up the proteins and fats of its prey, leaving just a small ball of undigested body parts.[2][3] This usually docile tarantula will kick hairs off the abdomen with its hind legs when threatened, which cause blindness if they hit the eyes of a predator and can also cause a rash on the skin.[3]

Conservation[edit]

The largest threat to the Curlyhair tarantula is now habitat loss. Once captured in large numbers for the international pet trade, the curlyhair tarantula is now bred in captivity worldwide and relatively few are caught in the wild.[2] Listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), the curlyhair tarantula can now only be traded internationally according to quotas and with trade permits.[4]

As pets[edit]

B. albopilosum is frequently kept and bred in captivity. They are highly adaptable to humidity and temperature changes and they feed readily on commercially available crickets, superworms, cockroaches and even small mice. They are typically docile. Females are long-lived, potentially reaching 15 years of age.

Gallery[edit]

References[edit]

This article incorporates text from the ARKive fact-file "Brachypelma albopilosum" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

  1. ^ "Eight: A site about tarantulas". April 2005. Retrieved July 21, 2011. 
  2. ^ a b c d e Baxter, R.N. (1993). Keeping and Breeding Tarantulas. Ilford, Essex: Chudleigh Publishing. 
  3. ^ a b c d e West, R. (2008) Pers. comm.
  4. ^ "CITES". CITES. April 2008. Retrieved July 21, 2011. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!