Overview

Brief Summary

Biology

The brown hare is predominantly nocturnal, spending most of the day in small depressions in the grass known as forms. At night the hare ventures out, grazing on the young shoots of grasses and herbs as well as agricultural crops. Hares escape predation by outrunning their enemies; with their powerful hind legs they can reach speeds of up to 45mph (2). Courtship involves boxing; this well-known 'mad March hare' behaviour actually involves unreceptive females fending off amorous males. Breeding usually occurs between February and September, females typically give birth to around 3 litters each year of 2-4 young (leverets). Leverets are born with their eyes open, and are left alone in the day in forms to avoid attracting predators. The mother returns at sunset and the leverets gather around her to suckle (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The general form and structure of the brown hare resembles that of the rabbit, but obvious differences include the hare's longer, larger body, much longer hind legs, and longer ears with black tips (2). Generally, brown hares are a brown-russet colour, with a white underside. The tail is black on the upper surface and white underneath. In contrast to rabbits, which have a brown iris, the brown hare has a golden iris and a black pupil (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The current Eurasian distribution of Lepus europaeus extends from the northern provinces of Spain, to introduced populations in the United Kingdom and southern regions of Scandinavia, south to northern portions of the Middle East, and has naturally expanded east to sections of Siberia (Flux and Angermann 1990). This species has been introduced as a game species extensively to countries across the globe. These countries are: Argentina, Australia, Barbados, Brazil, Canada, Chile, Falkland Islands, New Zealand (North and South Island), Rèunion, the United Kingdom and the United States (Flux and Angermann 1990). There is recent evidence of an introduced population in Ireland (Reid pers. comm.). This species can be found at elevations ranging from sea level up to 2,300 m (Spitzenberger 2002)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The natural distribution of European hares includes Great Britain and western Europe, east to through the Middle East to Central Asia (Lincoln, 1974; Broekhuizen and Maaskamp, 1980; Caillol and Meunier, 1989; Poli et al., 1991). They have been introduced by humans to several other continents. In Canada, Lepus europaeus is found in southern Ontario, around the Great Lakes, and south of the Canadian Shield. It has failed to spread further north. In the United States, European hares are now found in the north-eastern states and around the Great Lakes (Hall and Kelson, 1959). They have also been introduced to areas of South and Central America (Bonino and Montenegro, 1997) and Australia.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); neotropical (Introduced ); australian (Introduced )

  • Broekhuizen, S., F. Maaskamp. 1980. Behaviour of does and leverets of the European hare (Lepus europaeus) whilst nursing. J. Zool. Lond., 191: 487-501.
  • Lincoln, G. 1974. Reproduction and March madness in the Brown hare, Lepus europaeus. J. Zool. Lond., 174: 1-14.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to Europe and western Asia. Introduced in Ireland, southern South America, Australia, New Zealand, various islands (including Barbados, Reunion, and the Falklands), and southeastern Canada and northeastern U.S. (has been found from southern Ontario and Michigan, east through the Hudson River valley to Connecticut; probably not established in Michigan). See Hoffman (in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The brown hare is widespread throughout central and western Europe, including most of the UK, although it is absent from the northwest and western highlands in Scotland, where the species is replaced by the mountain hare (Lepus timidus) (5). It is likely that the Romans introduced the brown hare to Britain, as there are no records of this species before Roman times (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Total length: 600-750 (average 680) mm; Ear length, from notch: 94-102 (av. 98) mm; Tail: 72-110 (av. 95) mm; Hind foot: 142-161 (av. 151) mm; Skull length: 96-104 (av. 100) mm; Skull width: 44-51 (av. 47.3) mm (Peterson, 1966; Hall and Kelson, 1959). They have long ears with black tips and which are greyish white inside. The pelage is yellowish-brown to greyish-brown, with a greyish-white underbody. The face is brown, with eye rings. The tail is black on the top and white on the bottom. In winter, L. europaeus doesn't change its pelage to white, but does become slightly more grey (Peterson, 1966; Bansfields, 1974; Dragg, 1974). There is no noted sexual dimorphism. The skull features short, broad, heavy nasal bones, and prominent anterior and posterior lobes of the supraorbital processes. It also often has a prominent subcutaneous process of the lacrimal bone, projecting from the anterior wall of the orbit (Bansfield, 1974).

Range mass: 3 to 5 kg.

Range length: 600 to 750 mm.

Average length: 680 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 70 cm

Weight: 9100 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Lepus europaeus is a highly adaptable species that can persist in any number of habitat types (Flux and Angermann 1990). There is a positive association with hare abundance and habitat density and diversity (Smith et al. 2005). When available, weeds and wild grasses are selected by L. europaeus; however, intensified agro-practices have reduced this food source resulting in the selection of crop species (Reichlin et al. 2006).

L. europaeus averages three litters/yr, but can vary from one to four litters/yr (Macdonald and Barrett 1993). Litter size can vary with respect to the season, smaller litters produced earlier in the season and larger litters later (Macdonald and Barrett 1993). The birth weight of L. europaeus is approximately 100 g (Macdonald and Barrett 1993). Gestation is 41-42 days and reproduction occurs year round (Macdonald and Barrett 1993). Average life expectancy for this hare is 1.04 years, with a maximum age span in the wild of 12.5 years recorded in Poland (Macdonald and Barrett 1993). Females reach maturity around seven to eight months and male at six months (Macdonald and Barrett 1993). The total length of L. europaeus is 48.0-70.0 cm (Macdonald and Barrett 1993).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

European hares prefer open fields and pastures bordered by hedgerows and woodlots, often around agriculture fields and crops. They live in shallow forms; clumps of grass, weeds, or bush (Peterson, 1966; Bansfield, 1974; William and Whitaker, 1943).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers open country, mainly agricultural land. Open woodlands with sparse groundcover may also be used. Female usually does not build a nest. A hollow scrape near protective cover is utilized. Does not use burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The species mainly inhabits agricultural grassland in temperate, open habitats (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

European hares are herbivorous, eating grasses, herbs, and field crops during summer. During winter European hares feed on twigs, buds, shrub bark, small trees, and young fruit tree bark. They also commonly re-ingest their green, soft fecal pellets. This is known as coprophagia. Two or three adult L. europaeus can eat as much vegetation as one sheep (Banfield, 1974; William and Whitaker, 1943; Peterson, 1966).

Plant Foods: leaves; wood, bark, or stems

Other Foods: dung

Primary Diet: herbivore (Folivore ); coprophage

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In summer, eats grass and fruits; in winter, buds, bark and seedlings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

Known predators include red foxes, wolves, coyotes (in their introduced range in North America), wild cats, larger hawks, and owls (Bansfield, 1974).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home range is around 12 acres (Banfield 1974). In Ontario, average population density was 25 per square mile, with high densities at 100 per square mile occurring under ideal conditions (Banfield 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

European hares are usually quiet animals. They make low grunts from time to time and "guttural" calls from the doe (female) to her leverets. It has been suggested that European hares grind their teeth as an alarm call. They also emit a shrill call when hurt or caught (Peterson, 1966; Bansfield, 1974).

Communication Channels: acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Primarily nocturnal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
12.0 years.

Average lifespan

Status: captivity:
7.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.7 years (captivity) Observations: It has been estimated that these animals live up to 10.7 years in the wild (Bernhard Grzimek 1990), which is doubtful. One wild born specimen was about 10.7 years of age when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The breeding season for L. europaeus is between midwinter (January/February) and midsummer. The gestation period is between 30 and 42 days (Bansfield, 1974; Peterson, 1966). There is a high in-utero reabsorbtion rate; 7% in the spring to 25% in the autumn (Bansfield, 1974). Litter size varies between 1 and 8, the average being 3 to 5 (William and Whitaker, 1943; Bansfield, 1974). There are two to several litters a season. The weaning period is said to be about one month (Broekhuizen and Maaskamp, 1980; Bansfield, 1974). The young, called leverets, reach sexual maturity at eight months to a year in age. During autumn, the male's gonads and reproductive tract are regressed and plasma levels of testosterone and luteinizing hormone are low. In females, luteinizing hormone basal levels are at a maximum in July, the end of the reproductive season (Caillol and Meunier, 1989).

Breeding interval: There are two to several litters a season.

Breeding season: The breeding season for L. europaeus is between midwinter (January/February) and midsummer.

Range number of offspring: 1 to 8.

Average number of offspring: 3-5.

Range gestation period: 30 to 42 days.

Average weaning age: 30 days.

Average time to independence: 1 months.

Average age at sexual or reproductive maturity (female): 8 months.

Average age at sexual or reproductive maturity (male): 8 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 119.67 g.

Average number of offspring: 2.

Average age at sexual or reproductive maturity (female)

Sex: female:
236 days.

Leverets are precocial at birth, with long and silky fur (Peterson, 1966). To protect leverets, the mother disperses them over a moderately wide area to avoid predation on the whole litter. The mother then makes the rounds to nurse them (Bansfield, 1974).

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

  • Broekhuizen, S., F. Maaskamp. 1980. Behaviour of does and leverets of the European hare (Lepus europaeus) whilst nursing. J. Zool. Lond., 191: 487-501.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in January. Gestation lasts 42 days. Litter of 1-3 is born in March. Probably averages 2 litters per year. Sexually mature in first spring. Young are precocial.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lepus europaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0576-06|NC_004028|Lepus europaeus| AATCGTTGATTATTTTCTACCAACCACAAAGACATTGGAACTCTCTACCTTTTATTTGGAGCCTGAGCTGGAATGGTAGGAACAGCCCTA---AGTCTGTTGATCCGAGCAGAATTAGGCCAACCTGGGACTTTACTTGGAGAC---GATCAAATCTATAATGTTATTGTTACCGCGCATGCCTTCGTAATAATTTTCTTCATAGTTATACCTATTATGATTGGAGGCTTCGGGAACTGACTAGTTCCTCTAATG---ATTGGAGCCCCTGATATAGCTTTCCCCCGAATAAACAATATAAGCTTTTGACTTCTCCCACCATCTTTCCTTCTCTTATTAGCCTCATCTATAGTAGAAGCTGGCGCAGGAACTGGTTGAACTGTCTACCCACCCCTGGCTGGTAACTTAGCTCATGCAGGAGCTTCAGTTGACCTT---ACTATCTTTTCCTTACACTTAGCCGGAGTTTCATCTATTCTAGGGGCTATTAATTTTATTACTACTATTATTAATATAAAACCCCCTGCTATATCTCAATATCAGACACCCCTATTTGTATGGTCCGTTCTCATCACAGCTGTTCTTCTTCTCCTCTCTTTACCAGTTCTAGCTGCC---GGCATTACAATACTTTTAACAGACCGAAACTTAAATACAACTTTCTTCGACCCAGCAGGTGGTGGGGACCCTATTCTCTACCAACACTTATTTTGATTCTTCGGTCATCCTGAAGTGTATATTCTTATCCTACCAGGATTTGGGATAATTTCTCACATTGTTACCTACTATTCTGGGAAAAAA---GAACCATTTGGATACATAGGAATAGTATGGGCCATAATGTCAATTGGCTTCCTTGGATTTATTGTTTGAGCCCATCATATATTCACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lepus europaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Smith, A.T. & Johnston, C.H.

Reviewer/s
Smith, R.K. & Boyer, A.F. (Lagomorph Red List Authority)

Justification
Lepus europaeus is widespread and abundant across its geographic range (Flux and Angermann 1990). There is evidence of population declines beginning in the 1960s in association with the intensification of agricultural practices (Smith et al. 2005). It is listed under Appendix III of the Bern Convention in Europe (Vaughan et al. 2003). Several countries have placed L. europaeus on their Red List as "near threatened" or "threatened" (Reichlin 2006). There is growing concern regarding the status of regional forms of this species (Flux and Angermann 1990). Efforts should be made to ascertain total population decline for Europe and Asia (historic range) to determine if it qualifies for listing as Near Threatened.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

European hares are widespread throughout Europe, where they are called common hares. European hares have done well in North America, with population numbers quickly rising to the current density. In Ontario population density has been as high as 100 per square mile, and has leveled to about 25 per square mile (Bansfield, 1974; Dragg, 1974). In recent decades there have been outbreaks of increased mortality due to disease, particularly in Europe. This syndrome includes acute hepatosis, enteritis, nephrosis, general jaundice, congestion, and hemorrhage of internal organs, and has been called European Brown Hare Syndrome (Poli et al., 1991).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classed as a game animal so little legal protection (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Populations of Lepus europaeus have been experiencing declines in many areas across its geographic range in Europe (Flux and Angermann 1990). Population densities range from 0.1/ha to 3.4/ha (Flux and Angermann 1990).

A study conducted in the Czech Republic found mean hare densities were highest in habitat with the following characteristics (Pikula et al. 2004): elevation: sea level to 200 m (231.47/10 sq. km); annual snow cover duration: 40-60 days (183.95/10 sq. km); mean annual precipitation: 450-700 mm (174.71/10 sq. km); annual sunshine duration: 1801-2000 (169.72/10 sq. km); mean annual air temperature: >10.0˚C (245.00/10 sq. km); and Pikula et al. (2004) states the highest mean densities with respect to climatic areas was in: "A warm and dry district with mild winter and longer duration of sunshine; a warm and dry district with mild winter and shorter duration of sunshine; a warm and moderately dry district with mild winter" (227.91/10 sq. km) (Pikula et al. 2004).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
A study, reviewing available literature regarding population densities in connection with habitat that was identified as primarily farmland from 12 European countries, concluded that the primary cause of Lepus europaeus decline was intensification of agriculture (Smith et al. 2005). It is inferred that this threat is pertinent to the species across its geographic range where farming is practiced. Smith et al. (2005) also identified negative associations with predation and precipitation in respect to abundance. However, "Field size, temperature, precipitation, and hunting had no effect on density throughout Europe" (Smith et al. 2005). L. europaeus is susceptible to localized extinction when hare densities become too low (Soule 1987). In Greece, the restocking of hares has been identified as a threat to regional gene pools (Mamuris et al. 2001). This issue has also been identified as a concern for the Cantabric population in Spain (Palacios et al. 2004). Disease is an additional threat to L. europaeus and several have been identified as the principle sources of mortality (Lamarque et al. 1996). These diseases are European Brown Hare Syndrome (EBHS), Pasteurellosis, Yersiniosis (Pseudo-tuberculosis), Coccidiosis and tularaemia (Lamarque et al. 1996).

Genetic diversity of L. europaeus in the North Rhine-Westphalia region of Germany indicates that hare populations still retain sufficient diversity (Fickel et al. 2005). However, it is cautioned that restricted gene flow could eventually lead to allelic fixation and inbreeding depression within populations that become isolated (Fickel et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Numbers of the once abundant brown hare underwent a decline in the 1960s and 70s. The UK population now appears to be remaining fairly stable (3); current estimates put the winter population at between 600,000 to 800, 000 individuals (3).The decline was due to a combination of factors including the widespread intensification of agricultural practices, such as the conversion of grassland to arable crops, and changes in cropping regimes, which may remove important food sources at vital times of the year (2). Shooting, poaching and coursing are likely to have contributed to the decline, as has the increase in the numbers of the hare's major predator, the fox (Vulpes vulpes) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Lepus europaeus is recognized as an important game species throughout its distribution and as such conservation measures are required to halt declining populations (Flux and Angermann 1990). The recent decline of this species has garnered it protection under the Bern Convention as an Appendix III listing (Vaughan et al. 2003). In Norway, Germany, Austria and Switzerland, population declines have resulted in country-specific Red Listing as "near threatened" or "threatened" (Reichlin et al. 2006).

Research is needed to determine population dynamics specific to habitat type and the effects habitat change has on life history parameters with regard to declines (Smith et al. 2005). There is a lack of understanding as to why hare numbers are low in pastoral landscapes and therefore, research should be conducted within this habitat type with particular emphasis paid to demography and behavioral ecology (Smith et al. 2005). When population declines are the direct result of agricultural intensification, which results in increased application of fertilizer, landscape homogeneity and mechanization, population declines of L. europaeus can be countered by augmenting habitat to boost heterogeneity (Smith et al. 2005).

In Spain, molecular phylogenetic studies have shown that the Cantabric population has unique mtDNA in relation to other European populations (Palacios et al. 2004). As an important hunting species, declining numbers have prompted the importation of non-Iberian hares (from France and elsewhere) to supplement hare densities (Palacios et al. 2004). In an effort to conserve this population's gene pool, a captive breeding program has been implemented (Palacios et al. 2004). As of 2003 this program has successfully bred leverets and in 2004 turned its focus to increasing genetic variability by introducing individuals from new localities (Palacios et al. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The brown hare is a priority species under the UK Biodiversity Action Plan (UK BAP), the species action plan aims to maintain and expand existing populations, doubling spring numbers in Britain by 2010 (5). Aspects of hare ecology are currently being studied; this aims to guide conservation work (5). The species has minimal legal protection as it is classed as a game species. It is still hunted throughout its breeding season and is the only UK game species not to have a closed season, when hunting is prohibited (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In some areas, such as Argentina, Australia and, to a lesser extent, North America, L. europaeus is a pest. The problem lies in its quick reproduction and devastation to agriculture, especially young apple orchards (Bonino and Montenegro, 1997; Bansfield, 1974; William and Whitaker, 1943).

Negative Impacts: crop pest; causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

European hares have become an important and challenging game animal, especially in North America. The meat is said to be white and delicious (William and Whitaker, 1943; Bansfield, 1974).

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European Hare

The European hare (Lepus europaeus), also known as the brown hare, eastern jackrabbit and eastern prairie hare, is a species of hare native to northern, central, and western Europe and western Asia. It is a mammal adapted to temperate, open country. It is related to the similarly appearing rabbit, which is in the same family but a different genus. It breeds on the ground rather than in a burrow and relies on speed to escape.

Normally shy animals, hares change their behaviours in the spring, when they can be seen in broad daylight chasing one another around meadows. During this spring frenzy, hares can be seen "boxing", where hares strike one another with their paws. For a long time, this had been thought to be competition between males, but closer observation has revealed it is usually a female hitting a male, either to show she is not yet quite ready to mate or as a test of his determination.[3]

The hare is declining in mainland Europe due to changes in farming practices. Its natural predators include the golden eagle and carnivorous mammals, such as the red fox and wolf. Smaller hares native to southern Europe previously regarded as European hares have been split off as separate species in recent years, including the broom hare in northern Spain.

Contents

Taxonomy and genetics

One study of the nuclear gene pool of the European hare and the Cape hare suggests they may well be the same species.[4] However, a later study of the mtDNA of these same animals concluded they diverged significantly and are thus different species.[5] It has been suggested that in the case of hares whose evolution is rapid, species designation cannot be based solely on mtDNA and there needs to be examination of the nuclear gene pool.[6] It seems the genetic differentiation between the European and Cape hare is caused by geographic distance rather than divergence.[6] It has been speculated that in Near Eastern, hares are experiencing gene flow where populations meet and this may leave to intergraded populations.[6] It has been proposed that "a combined phylogenetic, phylogeographic, and population genetic approach,…, based on various nuclear and mitochondrial markers and including other biological characters, such as phenotypic and morphometric data," are needed for conclusive evidence of a single species complex.[7] However, the European hare remains classified as a true species until there is data found supporting a change its taxonomic status.[2]

There appears to be genetic diversity in the European hare in the North Rhine-Westphalia region of Germany.[8] However, it is possible that restricted gene flow could change this within populations that become isolated.[8] Based, on molecular phylogenetic studies the Cantabric population in Spain has unique mtDNA in relation to other European populations.[9]

Subspecies

A European hare (above) compared with a mountain hare

There are 15 recognized subspecies of European hare.[10]

Description

Portrait of hare

The European hare has a head and body length ranging from 600-750 mm with a tail length of 72–110 mm.[11] There is no noticeable sexual dimorphism in the species. As with all leporids, the hare has elongated ears which in this species ranges from 94–102 mm from the notch. The ears of the European hare are greyish white inside and have black tips on the top ends. It also has long hind feet that have a length from 142 to 161 mm. Most of the hare’s body is covered in yellowish-brown to greyish-brown fur but has greyish-white fur on the underside. In addition its face is brown with black rings around the eyes. Unlike some other leporids, the European hare’s fur does not turn white in the winter, but it does get slightly more grey.[11][12] The hare’s skull has a length from 96 to 104 mm and a width from 44 to 51 mm.[11] The skull has nasal bones that are short, broad and heavy as well as prominent anterior and posterior lobes of the supraorbital processes.[13] In addition, the skull has a prominent subcutaneous process of the lacrimal bone, projecting from the anterior wall of the orbit.[14]

Range and habitat

Hare running in open field

The European hare ranges from continental Europe though the Middle East and into central Asia. It was probably introduced to Great Britain in ancient times, partially replacing its close relative, the Mountain hare.[15] In more recent centuries the hare has been introduced to many other areas around the world: Eastern North America, South America, Australia, New Zealand and many islands including Tasmania, the Falklands, Barbados and Reunion.[16] The species was imported to North America from Germany by a farmer living near Cambridge, Ontario, Canada in 1912. It escaped from the farm, successfully colonized fields and woodland edges, and quickly made the "Jackrabbit" a common sight in southern Ontario, New York State and New England.

Hares primarily live in open fields and pasture usually near agricultural areas and bordered by hedgerows and woodlots. They prefer to live in shallow forms like clumps of grass, weeds or brush.[11] According to a study done in the Czech Republic the mean hare densities were highest in habitat with elevations from sea level to 200 m (231.47/10 km2), annual snow cover duration from 40–60 days (183.95/10 km2); mean annual precipitation: 450–700 mm (174.71/10 km2), annual sunshine duration: 1801-2000 (169.72/10 km2) and mean annual air temperature of around 10.0˚C (245.00/10 km2).[17] Climatic areas with the highest mean densities were found to have been "A warm and dry district with mild winter and longer duration of sunshine; a warm and dry district with mild winter and shorter duration of sunshine; a warm and moderately dry district with mild winter".[17]

Ecology and behavior

European hare displaying typical hiding behaviour at Uitkerkse Polders, Belgium

Outside of the mating season, the European hare lives a largely solitary lifestyle. It is mostly nocturnal and crepuscular and forages between 7:00 p.m. and 7:00 a.m.[13] During daytime, a hare will hide in a depression called a "form" where they are partially hidden.[14] Hares are capable of running in speeds of up to 35 mph (56 km/h) in a straight line.[13] When running from its predators, the hare can dodge and change direction quickly. They will even dive into streams and can swim.[14] Little evidence shows that hares stay within a restricted home range.[14] Predators of the hare include the red fox, wolf, coyote, wild cats and birds of prey.[14] Although they are usually quiet, hares will make low grunts and females will make "guttural" calls to her young. They emit a shrill call when caught or hurt.[11][14]

Food and foraging

Hare pellets

European hares are primarily herbivorous. During the summer, they eat grasses, herbs and field crops.[13] During the winter, they eat twigs, buds and the bark of shrubs and young fruit trees.[13] They have been known to eat their own green, pellet feces to recover proteins and vitamins.[13] Two to three adult hares can eat as much as one sheep.[11][14] Though normally comparatively solitary, European hares will forage in groups. Group feeding is beneficial as individuals can spend more time feeding, as there is increased corporate vigilance.[18] Nevertheless, the distribution of food affects the benefits of group foraging depend. When food is well-spaced, all hares are able to access it. When food is clumped together, dominant hares are able to monopolize this resource.[18] In small gatherings, dominants are able to exclude subordinates, but in larger gatherings, they must devote more time to defending the patch.[18] Therefore, dominants spend less time feeding as the group size increases, while subordinates feed more since they have more opportunities, since the dominants are chasing off others. As such, when in groups, all individuals fare worse when food is clumped as opposed to when it is spaced.[18]

Mating and reproduction

Hares during "March madness"

European hares have a prolonged breeding season which lasts from January to August.[3][19] At least some females, or does, have been found pregnant in all breeding months and males, or bucks, are fertile in all months of the year except in October and November.[19] After the rest period in autumn, the size and activity of the males' testes increase in November, the first indication of a new reproductive cycle. This continues though December, January and February and the reproductive tract becomes fully functional again. Matings proceed ovulation and the first pregnancies usually have one fetus, although pregnancy failures are common during time.[19] Full reproductive activity occurs by March and April and nearly 100% of females may become pregnant with most carrying three or more fetuses.[19] During breeding, females are receptive for just a few hours on one day in each of their six-weekly cycles.[3] Thus local bucks compete for a doe's favor with dominant males striving to keep the others at bay. In addition the female will fight off any male that approaches her before she is ready.[3] This phenomenon is known as "March madness". This is because the behavior is more often observed in March as the nights, the bucks preferred time for activity, are shorter and thus forces them to be active in the daytime.[3] A female will viciously fight off her suitors, giving them scarred ears. Hares have been observed to stand on their hind legs and hit each other with their paws, a practice known as "boxing" and this activity is usually between a female and a male and not between males as previously believed. When a doe is ready to mate, she will start a wild chase across the countryside, shaking off following males until only one remains. After this the female will stop and allow the remaining male to mate with her.[3]

Young hare hiding

The does continue to be highly fertile through May, June and July. However, the overt behaviour characteristic of spring reduces and testicular testosterone production drops.[19] By July and August the reproductive cycle ends and there is a reversal of the changes that took place earlier in the year. In August, the testes regress rapidly and by September sperm production ceases with the sperm reserves in the epididymis becoming progressively depleted and the sperm degenerate by October. Litter sizes reduce in numbers towards the end of the breeding season and by the end of August there appear to be no more pregnancies.[19] Young or leverets are born precocial from birth and have long, silky fur.[11] This is because hares do not give birth to their young below ground in a burrow but rather in a form. Thus hares are adapted to the lack of physical protection, relative to that afforded by a burrow. A mother will disperse her young over a moderately large area to lessen the chance of a predator preying on the whole litter. She will make the rounds to nurse them.[14] Young become independent at around a month old.

Status and human interactions

The March Hare with Alice, the Dormouse, and the Hatter from Alice's Adventures in Wonderland

The European hare is widespread and abundant across its geographic range.[20] However, population declines since in the 1960s have possibly been caused by the intensification of agricultural practices.[21] The Bern Convention of Europe list the hare under Appendix III.[22] Several countries have placed L. europaeus on their Red List as "near threatened" or "threatened".[23] The hare is considered a pest in some places, such as Argentina, Australia and North America. It causes damage to agriculture, particularly apple orchards.[14] European hares are also hunted as game animals and their meat is considered white and delicious.[14] Additional threats to the hare are the diseases European brown hare syndrome, pasteurellosis, yersiniosis (pseudo-tuberculosis), coccidiosis and tularaemia, which are principal sources of mortality.[24]

In culture

In modern paganism, the hare (or rabbit) is associated with the spring goddess Eostre. In Germany, the Netherlands, Belgium and some other European mainland countries, it still is the Easter hare rather than the Easter Bunny. The phase "mad as a March hare" was derived from observations of the hare’s breeding behavior. The hare is a character of some fables, such as The Tortoise and the Hare of Aesop. It also appears in Alice in Wonderland by Lewis Carroll, in which Alice participates in a tea party with the March Hare and the Mad Hatter.

References

  1. ^ Hoffman, Robert S.; Smith, Andrew T. (16 November 2005). "Order Lagomorpha (pp. 185-211". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 198-199. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ a b Smith, A.T. & Johnston, C.H. (2008). "Lepus europaeus". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/41280. Retrieved 2011-08-18. 
  3. ^ a b c d e f Holly T. (2001) "Mad World of the European Hare." from MacDonald, D. (Ed.), The New Encyclopedia of Mammals, Oxford: Oxford University Press, pp. 710-711.
  4. ^ Ben Slimen, H., Suchentrunk, F., Memmi, A. and Ben Ammar Elgaaied, A. (2005) "Biochemical genetic relationships among Tunisian hares (Lepus sp. ), South African Cape hares (L. capensis), and European brown hares (L. europaeus) ", Biochemical Genetics 43(11-12): 577-596.
  5. ^ Ben Slimen, H., Suchentrunk, F., Memmi, A., Sert, H., Kryger, U., Alves, P. C. and Elgaaied, A. B. A. (2006) "Evolutionary relationships among hares from North Africa (Lepus sp. or Lepus spp.), Cape hares (L. capensis) from South Africa, and brown hares (L. europaeus), as inferred from mtDNA PCR-RFLP and allozyme data", Journal of Zoological Systematics and Evolutionary Research 44(1): 88-99.
  6. ^ a b c Ben Slimen, H., Suchentrunk, F. and Ben Ammar Elgaaied, A. (2008) "On shortcomings of using mtDNA sequence divergence for the systematics of hares (genus Lepus): An example from cape hares", Mammalian Biology 72: 25-32.
  7. ^ Ben Slimen, H., Suchentrunk, F., Stamatis, C., Mamuris, Z., Sert, H., Alves, P. C., Kryger, U., Shahin, A. B. and Ben Ammar Elgaaied, A. (2008) "Population genetics of cape and brown hares (Lepus capensis and L. europaeus): A test of Petter's hypothesis of conspecificity", Biochemical Systematics and Ecology 36: 22-39.
  8. ^ a b Fickel, J., Schmidt, A., Putze, M., Spittler, H., Ludwig, A., Streich, W. J. and Pitra, C. (2005) "Genetic structure of populations of European brown hare: Implications for management", Journal of Wildlife Management 69(2): 760-770.
  9. ^ Palacios, F., Estonba, A., Perez-Suarez, G., Alonso-Campos, G., Sanz, A. and Galan, L. (2004) Report on the restoration program of the Cantabrian population of brown hare (Lepus europaeus Pallas, 1778) in the Basque Country, Spain, Research Center in Biodiversity and Genetic Resources, Vairao, Portugal.
  10. ^ Hoffmann, R. S. and Smith, A. T. 2005. Order Lagomorpha. In: D. E. Wilson and D. M. Reeder (eds), Mammal Species of the World, pp. 185-211. Johns Hopkins University Press, Baltimore, Maryland, USA.
  11. ^ a b c d e f g Peterson, R. (1966) The Mammals of Eastern Canada. Oxford University Press.
  12. ^ Dragg, A. (1974) Mammals of Ontario. Waterloo, Ontario: Otter Press.
  13. ^ a b c d e f Lepus_europaeus Animal Diversity
  14. ^ a b c d e f g h i j Bansfield, A. (1974) Mammals of Canada. Toronto: University of Toronto Press.
  15. ^ Yalden, D. W (2002). The History of British Mammals. Academic Press. ISBN 978-0-85661-110-0. 
  16. ^ Reid N. & Montgomery, W. I. (submitted to Royal Irish Academy). Naturalisation of the brown hare in Ireland. 
  17. ^ a b Pikula, J., Beklova, M., Holesovska, Z. and Treml, F. (2004) "Ecology of European brown hare and distribution of natural foci of tularaemia in the Czech Republic", Acta Veterinaria Brno 73(2): 267-273.
  18. ^ a b c d Monaghan. P., Metcalf. N. B., (1985) "Group foraging in wild brown hares: effects of resource distribution and social status", Animal Behaviour 33(3): 993-999
  19. ^ a b c d e f Lincoln, G. (1974) "Reproduction and March madness in the Brown hare, Lepus europaeus", J. Zool. Lond. 174: 1-14.
  20. ^ Fickel, J., Schmidt, A., Putze, M., Spittler, H., Ludwig, A., Streich, W. J. and Pitra, C. (2005) "Genetic structure of populations of European brown hare: Implications for management", Journal of Wildlife Management 69(2): 760-770.
  21. ^ Smith, R. K., Jennings, N. V. and Harris, S. (2005) "A quantitative analysis of the abundance and demography of European hares Lepus europaeus in relation to habitat type, intensity of agriculture and climate", Mammal Review 35(1): 1-24.
  22. ^ Vaughan, N., Lucas, E., Harris, S. and White, P. C. L. (2003) "Habitat associations of European hares Lepus europaeus in England and Wales: Implications for farmland management", Journal of Applied Ecology 10(1): 163-175.
  23. ^ Reichlin, T., Klansek, E. and Hackländer, K. (2006) "Diet selection by hares (Lepus europaeus) in arable land and its implications for habitat management", European Journal of Wildlife Research 52(2): 109-118.
  24. ^ Lamarque, F., Barrat, J. and Moutou, F. (1996) "Principal diagnoses for determining causes of mortality in the European brown hare (Lepus europaeus) found dead in France between 1986 and 1994", Gibier Faune Sauvage 13(1): 53-72.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly, L. europaeus was regarded as conspecific with L. capensis. Recent studies have indicated that the two apparently are distinct species; the form introduced into the New World is L. europaeus (see Jones et al. 1992; Hoffman and Smith, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!