Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Range Description

This species occurs in lowland to lower montane forests from south Tamaulipas and Oaxaca, México, through Central America, to western Colombia and Ecuador (Musser and Carleton 2005). Found below 2,500 m (in Mesoamerica generally below 1,500 m).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Oryzomys alfaroi
Catalog Number: USNM 99977
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): E. Nelson & E. Goldman
Year Collected: 1900
Locality: Teapa, Tabasco, Mexico, North America
  • Type: Merriam, C. H. 1901 Jul 26. Proceedings of the Washington Academy of Sciences. 3: 290.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Oryzomys alfaroi
Catalog Number: USNM 178660
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): E. Goldman
Year Collected: 1912
Locality: Cana (Santa Cruz de Cana), [upper Rio Tuyra (see Miller and Kellogg 1955:435)], Darien, Panama, North America
Elevation (m): 610
  • Type: Goldman, E. A. 1915 Jun 29. Proceedings of the Biological Society of Washington. 28: 128.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is nocturnal and terrestrial in forest and forest edge (Reid 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oryzomys alfaroi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 60 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATATCTTATCTTCGGTGCCTGAGCAGGAATAGTCGGCACAGCCCTAAGCATCATTATCCGAGCTGAACTGGGGCAACCAGGTACTCTATTAGGGGATGACCAAATCTACAATGTAGTAGTTACAGCCCACGCATTCGTAATAATTTTTTTCATAGTAATACCCATAATAATTGGGGGATTCGGAAATTGACTAGTACCACTTATAATTGGAGCCCCCGACATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTCCTCCCACCATCATTTCTTCTATTACTAGCATCATCGATAGTAGAAGCCGGAGCAGGGACTGGTTGAACAGTTTACCCACCATTAGCCGGCAACCTAGCCCACGCAGGAGCATCAGTAGACCTCACTATTTTTTCCCTTCACCTAGCAGGTGTATCATCCATTCTAGGGGCAATTAATTTTATTACAACTATTATTAACATAAAACCCCCAGCCATTACACAATATCAAACCCCCTTATTTGTCTGATCAGTTCTCATCACCGCCGTTCTACTTCTTTTATCCCTCCCAGTACTAGCCGCAGGAATTACTATACTCCTAACTGACCGCAACCTAAACACAACATTCTTCGACCCAGCAGGAGGAGGTGATCCAATCCTATATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oryzomys alfaroi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 67
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Handleyomys alfaroi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Timm, R., Matson, J., Tirira, D., Boada, C., Weksler, M., Anderson, R. P., Rivas, B., Delgado, C. & Gómez-Laverde, M.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, tolerance of a broad range of habitats, occurrence in a number of protected areas, and because it does not appear to be under threat and is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is uncommon (Reid 1997) to moderately common.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats at this time; however, deforestation is an important influence on its extent of occurrence.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in several protected areas. No conservation measures are needed for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Handleyomys alfaroi

Handleyomys alfaroi, also known as Alfaro's Rice Rat[1] or Alfaro's Oryzomys,[2] is a species of rodent in the genus Handleyomys of family Cricetidae. It is found in Belize, Colombia, Costa Rica, Ecuador, El Salvador, Guatemala, Honduras, Mexico, Nicaragua, and Panama. It was previously included in Oryzomys as Oryzomys alfaroi. Its natural habitats are subtropical and tropical lowland or montane dry forests at elevations ranging from sea level to 2500 m.[1]

References[edit]

  1. ^ a b c Timm et al., 2008
  2. ^ Musser and Carleton, 2005

Literature cited[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!