Tscherskia triton — Details

Greater Long-tailed Hamster learn more about names for this taxon

Overview

Distribution

Range Description

Learn more about this article

Distributed in NE China, Korea and Russian Far East.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology
Generally found in open xeric areas, marches with shrubs and river banks. Also found at field edges, along canals, roads, and rice fields. Constructs deep vertical burrows in which it caches vast quanties of seed in a large storage chamber. Feds on seeds of wild and cultivated plants (soy, corn, sunflower). Occasionally known to harvest leaves. Stores food for winter, up to 10 kg. Primarily nocturnal, although can be seen active during the day. Life expectancy about one year (they tend to waste away following breeding). Reproductive season from April to October (May to August in China). Breed 2-3 times and generally produce litters of from 8-10 young. Maximum registred litter size is 24.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Learn more about this article

Observations: Little is known about the longevity of these animals, but one specimen lived 4.6 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tscherskia triton

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2457-09|EU031048|Tscherskia triton| AACCGTTGACTCTTCTCAACCAACCACAAAGACATCGGAACTTTATACTTAATATTTGGTGCCTGAGCAGGTATAGTTGGCACAGCCCTT---AGTATTCTTATTCGAGCAGAACTGGGCCAACCCGGAGCCTTATTGGGAGAT---GATCAGATCTATAACGTAATCGTCACAGCCCATGCTTTCGTTATAATCTTCTTTATAGTTATACCCATAATAATTGGCGGCTTCGGAAACTGATTAGTACCCCTAATG---ATTGGTGCTCCAGATATAGCCTTCCCCCGCATAAATAATATAAGCTTCTGACTTCTTCCTCCCTCATTCCTCCTTCTTTTGGCCTCCTCTATAGTAGAGGCTGGAGCCGGAACTGGGTGAACAGTTTACCCGCCCTTGGCGGGAAACCTGGCCCACGCAGGGGCCTCTGTAGACCTC---ACTATTTTCTCACTCCATTTAGCCGGTGTTTCATCTATCCTCGGCGCAATTAATTTTATCACTACAATTATCAACATGAAGCCCCCTGCCATAACACAATACCAAACACCGCTGTTTGTGTGATCAGTCCTAATCACAGCCGTACTTTTACTTCTTTCCTTACCGGTGCTAGCAGCA---GGCATTACTATACTCCTCACAGATCGTAATTTAAACACAACATTCTTTGACCCGGCAGGCGGGGGCGATCCAATCTTATATCAACATTTATTTTGATTCTTTGGTCATCCAGAAGTCTACATCTTAATTTTACCAGGCTTTGGGATTATTTCCCATATCGTTACTTATTACTCAGGAAAAAAA---GAACCATTCGGTTACATAGGGATAGTGTGGGCAATAATATCCATTGGATTCCTCGGTTTCATTGTATGAGCTCACCACATATTTACAGTAGGTCTTG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Tscherskia triton

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 17
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Tsytsulina, K.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Justification
Species with stable population trend and no major threats.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Population

Learn more about this article

Population
There are no data available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Threats

Threats

Learn more about this article

Major Threats
No major threats to the species. However, change in water regime and marshes drainage may influence local distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions
Has been considered an agricultural pest. Listed in the China Red List as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Greater Long-tailed Hamster

Learn more about this article

The Greater Long-tailed Hamster (Tscherskia triton) is a major crop-eating rodent that resides in Northern China. It is the only member of the genus Tscherskia. Some authorities maintain that the 15th gua of the Yi Jing (I Ching) refers repeatedly to this animal. The animal has been a major pest since ancient times and also has a habit of standing up on its rear legs and screaming loudly.

References

  1. ^ Tsytsulina, K. (2008). Tscherskia triton. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 14 Jule 2009. Database entry includes a brief justification of why this species is of least concern.
Stub iconThis Cricetidae article is a stub. You can help Wikipedia by expanding it.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!