Overview

Distribution

Range Description

This species is found on peninsular Thailand (south of the Isthmus of Kra), the Malaysian Peninsula, and Indonesia (Sumatra, Borneo). In the Philippines, it occurs in the Palawan Faunal Region only being recorded from Arena, Bancalan, Busuanga, Calauit, and Palawan (Musser and Carleton 2005).
It is also found on many smaller islands, including Tioman island, Enggano island (south-west of Sumatra) and the Maratua Archipelago (east of Borneo), as well as the smaller islands of Pandjang, Rabu Rabu, Sangka Laki, Bilang Bilangan, Eraban, and Miang Besar off the east coast of Borneo (Musser and Califia 1982). It is also found on Busuanga (Musser 1977).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Rattus tiomanicus
Catalog Number: USNM 101763
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1899
Locality: Pulo [= Pulau] Tioman, Pahang, Malaysia, Asia
  • Type: Miller, G. S. 1900 Aug 20. Proceedings of the Washington Academy of Sciences. 2: 209.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 101665
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1899
Locality: Tambelan Islands [= Kepulauan Tambelan], Big Tambelan Island [= Pulau Tambelan Besar], Kepulauan Riau, Indonesia, Asia
  • Type: Miller, G. S. 1900 Aug 20. Proceedings of the Washington Academy of Sciences. 2: 212.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 151961
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1907
Locality: Pulo Mata Siri [= Pulau Matasiri], Borneo, Kalimantan Selatan, Indonesia, Asia
  • Type: Schwarz, E. & Schwarz, H. K. 1967 Mar 15. Anales de la Escuela Nacional de Ciencias Biologicas Mexico. 14: 132.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 197537
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): H. Raven
Year Collected: 1913
Locality: Pulo [= Pulau] Sanga Laki, Maratua Group, Borneo, Kalimantan Timur, Indonesia, Asia
  • Type: Schwarz, E. & Schwarz, H. K. 1967 Mar 15. Anales de la Escuela Nacional de Ciencias Biologicas Mexico. 14: 130.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 101705
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1899
Locality: Anambas Islands [= Kepulauan Anambas], [= Pulau] Siantan, Kepulauan Riau, Indonesia, Asia
  • Type: Miller, G. S. 1900 Aug 20. Proceedings of the Washington Academy of Sciences. 2: 210.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 112393
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1901
Locality: Saint Julian Island [= Kemudi], Kepulauan Riau, Indonesia, Asia
  • Type: Miller, G. S. 1903 Nov 06. Smithsonian Miscellaneous Collections. 45: 34.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 196752
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): H. Raven
Year Collected: 1912
Locality: Maratua Island [= Pulau Maratua], Borneo, Kalimantan Timur, Indonesia, Asia
  • Type: Miller, G. S. 1913 Dec 29. Smithsonian Miscellaneous Collections. 61 (21): 12.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 112723
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1901
Locality: Pulo [= Pulau] Tinggi, Johor, Malaysia, Asia
  • Type: Miller, G. S. 1913 Dec 29. Smithsonian Miscellaneous Collections. 61 (21): 9.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 112444
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1901
Locality: Pulo Aor [= Pulau Aur], Johor, Malaysia, Asia
  • Type: Miller, G. S. 1913 Dec 29. Smithsonian Miscellaneous Collections. 61 (21): 10.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 123861
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1903
Locality: Pulo Lankawi [= Pulau Langkawi], Kedah, Malaysia, Asia
  • Type: Miller, G. S. 1913 Dec 29. Smithsonian Miscellaneous Collections. 61 (21): 13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 104828
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1900
Locality: South Natuna Islands [= Kepulauan Natuna Selatan], Sirhassen Island [= Pulau Serasan], South China Sea, Kepulauan Riau, Indonesia, Asia
  • Type: Miller, G. S. 1913 Dec 29. Smithsonian Miscellaneous Collections. 61 (21): 13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 145497
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1907
Locality: Pulo Lamukotan [= Pulau Lemukutan], Borneo, Kalimantan Barat, Indonesia, Asia
  • Type: Lyon, M. W. 1911 Apr 25. Proceedings of the United States National Museum. 40: 100.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 145511
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1907
Locality: Pulo [= Pulau] Datu, Borneo, Kalimantan Barat, Indonesia, Asia
  • Type: Lyon, M. W. 1911 Apr 25. Proceedings of the United States National Museum. 40: 99.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 196751
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): H. Raven
Year Collected: 1912
Locality: Maratua Island [= Pulau Maratua], Borneo, Kalimantan Timur, Indonesia, Asia
  • Type: Miller, G. S. 1913 Dec 29. Smithsonian Miscellaneous Collections. 61 (21): 10.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 141193
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1905
Locality: Nias Island, mouth of Mojeia River, Sumatra, Sumatera Utara, Indonesia, Asia
  • Type: Miller, G. S. 1911 Feb 24. Proceedings of the Biological Society of Washington. 24: 26.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Rattus tiomanicus
Catalog Number: USNM 112349
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): W. Abbott
Year Collected: 1901
Locality: Saint Barbe Island [ = Pulau Pejantan], South China Sea, Kepulauan Riau, Indonesia, Asia
  • Type: Miller, G. S. 1913 Dec 29. Smithsonian Miscellaneous Collections. 61 (21): 9.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is apparently found only in a variety of habitats in the lowland areas: from secondary forest, agricultural areas, plantations, gardens, scrub, to grassland (Sanborn 1952; Payne et al. 1985), while Esselstyn et al. (2004) found it in grassland-forest mosaic, selectively logged forest, rice fields, mossy forest, and the transition zone between mossy and montane forest.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rattus tiomanicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGTTGACTCTTTTCAACTAACCACAAAGATATCGGAACCCTCTATCTATTATTTGGTGCCTGAGCAGGAATAGTGGGAACAGCCTTAAGTATTTTAATTCGAGCTGAACTGGGACAACCAGGAGCACTCCTAGGCGAT---GACCAAATCTATAACGTCATTGTTACAGCCCATGCATTCGTAATAATCTTCTTTATAGTCATACCAATAATAATCGGAGGCTTCGGAAACTGACTCGTACCACTAATGATCGGAGCCCCTGATATAGCATTCCCACGAATAAACAACATAAGCTTTTGATTGCTTCCCCCATCATTCTTACTTCTCTTAGCGTCATCCATAGTAGAAGCCGGAGCCGGAACAGGATGAACAGTATATCCACCCTTAGCCGGTAATCTAGCCCATGCTGGAGCATCCGTTGACTTAACCATTTTCTCCCTTCACCTAGCTGGTGTATCCTCTATCTTAGGGGCTATTAACTTTATCACCACTATTATCAATATAAAACCCCCTGCCATAACCCAATATCAAACACCCCTATTTGTGTGATCCGTATTAATTACAGCTGTACTTCTACTTCTCTCACTACCAGTATTAGCAGCAGGTATTACCATACTCCTCACAGACCGAAACCTAAATACTACTTTTTTCGATCCTGCTGGAGGCGGAGATCCAATTCTCTATCAACATCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rattus tiomanicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aplin, K. & Frost, A.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, tolerance of a broad range of habitats, and because its population is likely to be increasing. It is considered a pest in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common and widespread.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in several protected areas across the range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Malayan field rat

The Malayan Field Rat (Rattus tiomanicus) is a species of rodent in the family Muridae. It is found in Indonesia, Malaysia, the Philippines, and Thailand.

References[edit]

  • Baillie, J. 1996. Rattus tiomanicus. 2006 IUCN Red List of Threatened Species. Downloaded on 20 July 2007.
  • Musser, G. G. and M. D. Carleton. 2005. Superfamily Muroidea. pp. 894–1531 in Mammal Species of the World a Taxonomic and Geographic Reference. D. E. Wilson and D. M. Reeder eds. Johns Hopkins University Press, Baltimore.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!