Overview

Distribution

Range Description

This species is present in Australia and on the island of New Guinea (Indonesia and Papua New Guinea). In New Guinea, it ranges eastwards from Koemba (Papua Province, Indonesia) to Milne Bay Province (Papua New Guinea) (Flannery 1995a); the south-eastern peninsula populations may represent a different species. In Australia, it is generally found in the north and east of Queensland ranging about as far south as the Mackay range (Shoalwater Bay) (Aplin and Redhead 2008). Specimens reported from northern coastal New South Wales (specimens in the CSIRO wildlife collection; M. Ellis pers. comm.) represent R. tunneyi. There is an isolated population on South West Island, but it may have been extirpated. It is found from sea level to 670 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in canefields, tropical grasslands, savanna, open woodland and grassy glades within tropical moist forest (Flannery 1995a; Aplin and Redhead 2008). It can breed throughout the year, with females giving birth to litters of around six young (Aplin and Redhead 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rattus sordidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTAAACCGTTGACTATTTTCAACCAACCACAAAGATATCGGAACCCTCTATTTATTATTTGGTGCCTGAGCAGGGATAGTAGGAACAGCCTTAAGCATTTTAATTCGAGCTGAATTAGGACAGCCAGGCGCACTCCTAGGCGATGACCAAATCTATAATGTTATCGTCACAGCCCATGCATTCGTAATAATTTTCTTTATAGTTATACCGATAATAATCGGAGGCTTCGGAAACTGACTAGTACCACTAATAATTGGAGCCCCTGACATAGCATTCCCACGAATAAATAACATAAGCTTTTGATTACTTCCTCCATCATTTCTACTTCTCTTAGCATCATCCATAGTAGAAGCCGGAGCAGGAACAGGATGAACAGTGTACCCCCCTTTAGCCGGAAATCTAGCCCACGCCGGAGCATCTGTAGACTTAACTATTTTCTCCCTTCACCTAGCCGGGGTATCCTCTATCTTAGGGGCTATCAACTTTATTACAACTATCATTAATATGAAACCCCCTGCCATAACCCAATACCAAACGCCTCTATTCGTATGATCAGTATTGATTACAGCCGTCCTACTACTTCTCTCATTACCAGTATTAGCAGCGGGTATTACTATGCTTCTTACAGACCGAAACCTAAATACTACTTTCTTCGACCCTGCCGGAGGAGGAGACCCTATCCTATATCAACACCTATTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTTATCCTCCCAGGGTTTGGAATTATTTCACACGTAGTTACTTACTACTCTGGGAAAAAAGAACCATTTGGGTATATAGGAATAGTTTGAGCCATAATATCTATTGGCTTCCTAGGATTTATCGTATGAGCACACCACATATTTACAGTAGGCCTAGACGTAGACACACGAGCCTACTTTACATCCGCCACTATAATTATCGCAATTCCTACAGGCGTTAAAGTATTCAGCTGACTTGCCACCCTACACGGAGGCAATATCAAATGATCCCCTGCTATACTATGAGCCTTAGGATTTATTTTCTTATTTACAGTAGGAGGCCTAACCGGAATCGTTCTATCCAACTCATCACTTGACATTGTGCTTCATGACACATACTATGTAGTAGCCCATTTCCACTATGTTTTATCTATAGGAGCAGTATTCGCCATTATAGCTGGCTTTGTCCACTGATTCCCACTATTCTCAGGATATACCCTAGATGACACATGAGCTAAAGCCCATTTTGCCATTATATTCGTAGGTGTTAACATAACATTTTTCCCTCAACACTTCCTAGGGTTATCAGGTATACCTCGCCGATACTCCGATTATCCAGATGCTTACACCACATGAAACACAATCTCATCTATAGGCTCATTCATCTCACTTACAGCTGTCCTTGTTATAATCTTTATAATTTGAGAAGCCTTTGCATCAAAACGAGAAGTACTCTCAGTTTCTTACTCTTCAACAAACCTAGAATGACTTCACGGATGTCCCCCACCTTATCACACATTCGAAGAACCTTCCTACGTTAAAGTTAAGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rattus sordidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aplin, K., Helgen, K., Dickman, C. & Burnett, S.

Reviewer/s
Lamoreux, J. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of habitat modification, large population, lack of major threats, and because it is not declining.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is generally an abundant species, although in southern parts of Australia, particularly south-eastern Queensland, it is rare.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in a number of protected areas. Further studies into the taxonomy of this species are needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dusky field rat

The dusky field rat (Rattus sordidus) is a species of rodent in the family Muridae. It is found in Australia, Indonesia, and Papua New Guinea. In Australia it is found in northern Queensland and along the east coast as far south as Shoalwater Bay.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!