Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

It is not true that moles are blind, however they are very poor-sighted. They have hefty digging paws, they use to dig underground burrows. The mole is common throughout the Netherlands, with the exception of the Wadden Islands. Although they can swim, the distance to the islands is too far for them.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Moles spend most of their lives underground in a system of permanent tunnels (2), the presence of which can be detected from above by molehills, by-products of the excavation process (2). They feed on soil invertebrates that fall into the tunnels (4). A favourite component of the diet is earthworms, which are often stored for later consumption after they have been immobilised by a bite to the head (4). This species of mole is typically solitary, and both sexes defend their territories vigorously (4). Males extend their tunnel systems during the short breeding season as they search for females (4); a single litter per year is the norm, averaging between 2 to 7 naked, blind young. The young are suckled for about a month and leave the nest at around 33 days of age (2), they then disperse above-ground; this period of the mole's life is the most fraught with danger, as they are extremely vulnerable to predators including owls, buzzards, stoats, dogs and cats (2). Female moles are the only mammals known to posses reproductive organs called 'ovotestes', which contain a normal functioning ovary as well as a testicular area that produces a large amount of testosterone. This intriguing feature may explain why female moles are as aggressive as males when defending their territories; it may also account for the external similarities between males and females (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The European mole has an elongated, cylindrical body, covered in black, velvety fur (4). Although the eyes are complete, they are tiny, and often hidden by fur (4). There are no external ears and the nose is naked, apart from sensitive whiskers (4). The large, spade-like forepaws are well adapted for digging, with five robust claws and a permanently out-turned position (4). The sexes are very similar in appearance, but males are usually slightly larger (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The European mole occurs from Britain and Spain eastwards through much of continental Europe to the rivers Ob and Irtysh in Asian Russia (Corbet 1978, Kryštufek 1999, Wilson and Reeder 2005). In the Mediterranean, it is generally widespread on the European continent, although absent from southern Iberia, southern Italy, the southern Balkans (where it is replaced by other Talpa species). It is found on many islands in the Baltic and around the British coast, but it is not found on Ireland, Iceland, the North Sea islands, and the Mediterranean islands (with the exception of Cres in the northern Adriatic). It is found from sea level to 2,400 m (Kryštufek 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Talpa europaea is found throughout temperate Europe, from Great Britain in the west to the Ob and Irtysh rivers in the east in Russia. They do not occur in southernmost parts of Europe, including Greece, Portugal, and Italy.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Widespread and common throughout Britain but absent from Ireland and most islands, with the exception of Jersey, the Isle of Wight, Anglesey, Mull, Alderney and Skye (3). It is widespread in Europe except for the more southern countries (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

European moles weigh between 72 and 128 g. They are lean creatures and rarely have more than 3 grams of fat stored in the body. Body lengths range from 113 to 159 mm with tail lengths between 25 and 40 mm.  European moles have long, cylindrical bodies. Their fur is velvety and black in color. They have fully developed eyes that are small and often hidden by fur and no external ears. The nose is bare with the exception of sensory whiskers. They have well-adapted front limbs for digging. The front feet have 5 strong claws and are permanently turned outward. There is only slight sexual dimorphism, with males usually slightly larger.

Range mass: 72 to 128 g.

Range length: 113 to 159 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Gorman, M., D. Stone. 1990. The Natural History of Moles. Ithaca, New York: Comstock Publishing Associates.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is present in most habitats where there is sufficiently deep soil to permit the construction of its extensive burrows. It prefers meadows, pastures, arable land, gardens and parks, and is rarely found in coniferous forests, or habitats with sandy, stony or permanently waterlogged soils (Kryštufek 1999). It feeds mainly on earthworms, as well as other soil invertebrates (Niethammer 1990).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European moles are found in habitats with soils deep enough to allow tunneling. These include arable fields, deciduous woodland, and permanent pasture. Unless accidentally exposed to light, European moles spend their entire life underground, a highly variable habitat. Talpa europaea does not do well in sandy soils or newly cultivated land, as these environments are not suitable for burrowing. When T. europaea does burrow in these types of land, the tunnels are usually short-lived surface tunnels. Talpa europaea forms extensive networks of permanent, underground tunnels in more stable soils. This complex network of burrows is found at varying depths in the soil, and can be hundreds of meters long. The deepest tunnels are used most in times of drought and low temperature. Permanent tunnels are used repeatedly for feeding over long periods of time, sometimes for several generations of moles. Within the tunnels, T. europaea constructs one or more spherical nests, each lined with a ball of dry plant matter. These are used for sleeping and raising young.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in many habitats with soil deep enough to allow tunnelling (2), including arable fields, deciduous woodland, and permanent pasture (3). They do not commonly occur in coniferous forests, sand dunes, or moorland, possibly because invertebrate prey is scarce in these habitats (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

European moles feed on invertebrates. There are three methods used by moles for obtaining food. These include 1) digging in the soil, 2) walking through the burrow system, and 3) searching on the surface of the ground. The relative importance of these methods for a particular mole depends on soil conditions and the experience of the individual mole. Talpa europaea is polyphasic, spending most of its active periods in search of food.

Earthworms are the main constituent of the T. europaea diet in habitats where they constitute a majority of the biomass of the soil fauna. In areas without as many earthworms, insects are the main dietary constituent. Moles eat both larval and adult insects.

Animal Foods: eggs; insects; terrestrial non-insect arthropods; terrestrial worms

Primary Diet: carnivore (Insectivore , Vermivore)

  • Beolchini, F., A. Loy. 2004. Diet of syntopic moles Talpa romana and Talpa europaea in central Italy. Mammalian Biology, 69/2: 140-144.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Cyclospora caryolytica endoparasitises intestine of Talpa europaea

Animal / parasite / endoparasite
Elleipsisoma talpae endoparasitises red blood cells of Talpa europaea

Animal / dung saprobe
fruitbody of Hebeloma radicosum is saprobic in/on dung or excretions of nest of Talpa europaea
Other: major host/prey

Animal / parasite / ectoparasite / blood sucker
Hystrichopsylla talpae talpae sucks the blood of Talpa europaea
Other: major host/prey

Animal / predator
Talpa europaea is predator of diapausing pupa of Chrysolina graminis

Animal / parasite / endoparasite
Trypanosoma talpae endoparasitises blood plasma of Talpa europaea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Talpa europaea changes its habitat when it introduces networks of underground burrows. Moles are predators of insects and worms, and prey for certain kinds of birds and larger mammals. European moles are hosts for a number of parasites, including fleas, ticks, and worms.

Ecosystem Impact: creates habitat; soil aeration

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Moles are susceptible to predators mainly during the rare moments when they can be found above ground. They are most susceptible when they are young and leave the mother's nest to disperse above ground and find a territory. Predation on moles most commonly occurs during the spring and summer months. The main predators are birds, including owls, buzzards, herons, ravens, and gulls. Dogs and cats are also known to catch moles in the spring and summer. Humans remain the number one threat to moles, however, as they are considered agricultural pests and are actively persecuted.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Moles use urine to mark their territory. Both males and females have a pair of scent glands beneath the skin. These glands are slightly larger in males, but increase in size in both sexes during the breeding season, indicating that scent is important in finding a mate.

Communication Channels: chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

During late summer, a Talpa europaea population was shown to include 45 percent juveniles (moles less than one year in age), 40 percent one to two year olds, and the remainder older moles, with a maximum age of five years. The highest mortality rate occurs at an age of five to six weeks, when the moles leave the mother's nest to disperse above ground and find their own territory. They are extremely vulnerable to larger predators when above ground.

Range lifespan

Status: wild:
5 (high) years.

Typical lifespan

Status: wild:
2 to 3 years.

Average lifespan

Status: wild:
2-3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals. It has been reported that they live up to 6 years (Symonds 1999). Without more detailed studies, however, their maximum longevity must be classified as unknown.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating occurs during a short breeding season in the spring (March to May). Talpa europaea is typically a solitary and territorial species; however, during the mating season males extend their burrows as they search for females. For most of the year, males and females look very much alike. During the breeding season, females become easily recognizable. Around mid-February, two small pits appear just behind the clitoris. These expand and come together, forming a transverse slit leading to the vagina, which is inside the abdomen. Internal sex organs in both males and females increase greatly in size during the breeding season.

The behavior of female moles changes little during the breeding season. They remain in the areas inhabited during the winter. Males, who tend to remain in the same area during the winter months, may move considerable distances during the breeding months (up to a half of a mile) in search of mates. They travel through existing tunnel systems, and if no burrows are available they may dig new ones.

Copulation has been observed above ground. It is not known if this is common or if these instances are exceptional. Copulation has also been observed in underground nests, by the use of radioactive markers and subsequent trapping.

Mating System: polygynandrous (promiscuous)

Talpa europaea has one annual breeding season in the spring from March to May. During this time, nearly all female moles caught in traps are pregnant.

Gestation lasts four weeks in T. europaea. The young are typically born in mid to late April. Generally females give birth to a single litter per year. Each litter has two to seven young, born blind and hairless. The mother nurses her young for about a month. Fur starts to grow at 14 days, and eyes begin to open at 22 days. Talpa europaea young grow rapidly and reach their adult size in about three weeks. The young begin to leave the nest at 33 days, and disperse from their mother's range around five or six weeks after birth. Moles are sexually mature during the breeding season in the spring following birth. Interestingly, female and male T. europaea show little sexual dimorphism for most of the year, but around the time of breeding season the sex organs differentiate.

Breeding interval: European moles breed once yearly.

Breeding season: Breeding occurs from March to May.

Range number of offspring: 2 to 7.

Average number of offspring: 3.

Average gestation period: 33 days.

Average weaning age: 4 weeks.

Average time to independence: 35 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 3.25 g.

Average gestation period: 28 days.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
182 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
182 days.

After birth, the young remain in the nest for about 33 days. During this time, the young are fed entirely with the mother's milk. They begin to leave the nest at about 33 days, but remain with the mother for another two or three weeks. During the early days, if her young are disturbed the mother carries them to another nest. The mother remains with her young during her resting periods, but leaves them for two hours or more while searching for food for herself. At five or six weeks after birth, the young disperse above ground to find their individual territories. This is the part of the mole life cycle at which they are most vulnerable to predators.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Mellanby, K. 1971. The Mole. Great Britain: William Collins Sons & Co Ltd.
  • 2006. "ARKive: Images of Life on Earth- Mole (Talpa europaea)" (On-line). Accessed March 24, 2006 at http://www.arkive.org/species/ARK/mammals/Talpa_europaea/.
  • 2006. "The Mammal Society" (On-line). Fact sheet: the Mole Talpa europaea . Accessed April 18, 2006 at http://www.abdn.ac.uk/mammal/mole.shtml.
  • Haeck, J. 1969. Colonization of the Mole (Talpa europaea L.) in the Ijsselmeerpolders. Netherlands: Netherlands Journal of Zoology.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Talpa europaea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATCAACCGTTGATTATTCTCAACAAACCACAAAGATATCGGCACATTATATCTGCTATTCGGCGCCTGAGCCGGAATAGCTGGTACAGCCCTAAGCTTATTAATTCGTGCTGAACTAGGACAACCAGGTACTCTACTAGGAGATGACCAAATCTACAATGTAATTGTAACAGCCCACGCTTTCGTGATAATCTTCTTTATGGTTATGCCAATTCTACTAGGTGGATTCGGCAACTGACTAGTTCCACTAATAATCGGGGCACCCGATATAGCATTCCCCCGAATAAACAACATAAGCTTTTGACTTCTACCACCATCATTCTTACTATTACTAGCATCCTCCACAGTTGAAGCAGGGGCTGGTACAGGATGAACCGTATACCCACCCCTAGCAGGAAACTTAGCCCATGCCGGAGCTTCTGTAGACCTAGCTATTTTCTCTCTACACCTGGCAGGTGTTTCGTCTATTTTAGGAGCAATCAACTTTATCACAACTATCATTAACATAAAACCACCAGCAATATCCCAGTACCAAACCCCACTATTTGTGTGATCAATTTTAATTACTGCCGTACTACTATTACTCTCGCTTCCAGTTCTAGCTGCCGGCATCACTATACTTTTAACAGACCGAAATCTAAACACTACATTCTTTGACCCAGCCGGGGGTGGCGACCCTATTCTATACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTCTATATTTTAATTCTGCCCGGATTTGGAATTATTTCACACATTGTAACATACTACTCAGGAAAAAAAGAACCATTCGGATACATAGGAATAGTATGGGCAATAATATCAATTGGATTCTTAGGGTTCATCGTATGAGCCCACCACATGTTCACAGTAGGACTAGACGTAGATACACGTGCATACTTTACATCAGCAACTATAATTATTGCTATTCCAACTGGGGTAAAAGTATTTAGCTGACTGGCGACCCTGCATGGAGGAAATATTAAATGATCACCAGCCATATTATGAGCCCTTGGCTTTATTTTTCTATTTACAGTAGGGGGATTAACGGGAATTGTCCTAGCCAACTCCTCACTAGATATTGTCTTACACGACACATATTACGTGGTAGCCCACTTCCACTATGTGCTATCTATGGGAGCGGTATTTGCTATTCTTGCAGGATTTGTACACTGATTCCCACTATTTACAGGCTACACACTAAGTCAAACCTGAGCAAAAATTCACTTCGCCATTATATTTGTAGGAGTAAATATAACATTCTTTCCTCAACACTTCTTAGGCCTATCAGGTATGCCTCGACGTTATTCAGACTACCCAGACGCATACACCACATGAAACACAGTATCATCCATAGGATCATTCATTTCACTAACAGCAGTAATACTAATAGTATTTATGATCTGAGAGGCTTTCGCTTCAAAACGAGAGGTCTCTACTGTGGAATTAACAACAACCAATATCGAGTGACTGCATGGTTGTCCACCACCCTACCACACATTTGAAGAACCTACATACGTAAACCCAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Talpa europaea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Amori, G., Hutterer, R., Mitsain, G., Yigit, N., Kryštufek, B. & Palomo, L.J.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is widespread and abundant, with no serious threats at present. Consequently it is assessed as Least Concern.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European moles are common and widespread throughout their range, they are not considered at risk currently.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common in the UK and not protected (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is generally common in appropriate habitats, with densities of up to 16 individuals per hectare recorded (Kryštufek 1999). It is sufficiently common to be considered a pest of farmland and lawns in many parts of its range.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
It is widely persecuted as a pest, but although this may cause local population declines it is not a serious threat to the species. In the past, it was hunted in great numbers for its fur, but mostly in the northern parts of its range (outside of the Mediterranean) and this no longer occurs anyway.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Moles are not protected by law in the UK, and they are considered to be pests by many farmers and horticulturalists (2), although there are doubts as to whether this perception is correct (3). Historically, they have been trapped on a huge scale, and the pelts were used to make garments (4). Today moles are controlled by strychnine poisoning. This poison, available only by license and banned under the Animal (Cruel Poisons) Regulations (1963) except for use against moles (3), causes a slow painful death; it is also dangerous to other wildlife and humans (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in protected areas within its range. No specific conservation measures are recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There is no conservation action targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Talpa europaea is widely regarded as an agricultural pest. The burrowing habits and raising of molehills can cause damage to farmland, and heavy mole infestation can lead to serious economic problems for the farmers. Newly cultivated and planted arable fields are habitats where moles can move easily through the surface soil. This can cause damage to the roots of young plants, to the extent that they wilt or die. Mole hills can also cause damage to the blades of mowing machines and grain harvesters later in the year. This can cause expensive delays in the harvest. Many farmers make serious efforts to stop mole populations from occupying their land, using traps or poisons.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Moles help control some kinds of injurious insects and they may improve fertility of soils by aerating them.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European mole

The European mole (Talpa europaea) is a mammal of the order Soricomorpha. It is also known as the common mole and the northern mole.[3]

This mole lives in an underground tunnel system, which it constantly extends. It uses these tunnels to hunt its prey. Under normal conditions the displaced earth is pushed to the surface, resulting in the characteristic molehills. It feeds mainly on earthworms, but also on insects, centipedes and even mice and shrews. Its saliva contains toxins which paralyze earthworms in particular.[4]

It has a cylindrical body and is around 12 cm (5 inches) long. Females are typically smaller than males. The eyes are small and hidden behind fur, while the ears are just small ridges in the skin. The fur is usually dark grey, but the actual range of colors is larger, as due to the subterranean habits there is no disadvantage in having off-colored fur. European moles with white, light grey, tan, taupe, and black fur have all been reported.[citation needed]

Contents

Habitat

While moles are typically found in tunnel systems, the European mole is not exclusively an underground dweller. In the spring and early summer when the young moles leave the mother’s burrows they must find new territory. This forces them to leave their burrow and they can either make new tunnel systems or enter existing systems. In the summer time, however, they will likely burrow much more superficially. The superficial burrowing could be due in part to the soil that is much harder, which makes burrowing a greater challenge.[5]

T. europaea have also been found to spend a lot of time at the sides of drainage lines and streams but do not inhabit flooded or dry soils. However, dry areas do become important when their normal habitats become flooded. Factors such as the type of soil, vegetation present, and altitude have no effect on the areas that moles choose to inhabit. The one factor that does greatly influence the mole population in a specific area is the abundance of earthworms. One would expect for the earthworm population to decrease as the moles feed, however no research has shown this to be true.[6]

Reproduction

From June to January the mole is sexually inactive and has only one relatively short breeding season that occurs in the spring. Mating occurs over a span of a few weeks in March and April, followed by a gestation period of 4–5 weeks. Most births will occur at the end of April or at the beginning of May. The litter size ranges from 2–7. There is a lactation period that follows, where the young remains at the mother’s nest for 4–5 weeks but at the end of June the young are usually required to leave the tunnels.[7]

Feeding habits

One common thought of moles is that they typically consume their own weight in food every 24 hours but this is an exaggeration. Studies have been performed that show moles actually eat about half of their body weight in food each day. When in captivity, moles will eat a wide variety of food items including liver, mice, mealworms, shrews and maggots. However, they always tend to prefer earthworms to all other options.[5]

Vision

Due to the subterranean nature of this mole, there is an anatomical regression of its eyes at several organizational levels. Its eye has a diameter of only 1mm and it is buried beneath fur and has a cellular lens. The organization of the retina is quite similar to that of a typical mammal. It has been determined that there are about 2000 ganglion cells and the optic nerve is roughly 50 μm with 3000 axons. Roughly 15% of these axons are myelinated. The photoreceptors are not the normal rod-like or cone-like shape that you would expect to see. Instead they all have one uniform shape with three distinct features:

  1. The receptors are short along the radial axis
  2. The inner and outer segments are similar in length
  3. The outer segments appear to be significantly degenerated

Studies have shown that T. europaea does have photopic vision, contrary to popular belief that all moles are blind. Two cone opsins have been found in the eyes of T. europaea but their function is still under investigation. In a study of the mole eyes it was found that Talpa withdraws when exposed to a flashlight and it can also perform light/dark discrimination tasks. The cone cells in the eye are unlikely to provide high-resolution vision but they could allow a detection of movement and some hue discrimination. It is suggested that in subterranean mammals vision is used to detect predators that have broken into the tunnels.[8]

Hearing

In mammals the cues for hearing are usually based on inter-aural intensity differences, which occur as a result of the diffraction of a progressive sound wave by the head and pinna. They could also be based on inter-aural time differences that are present because of the distance between their two ears. Moles have no pinna so they are thought to hear at low frequencies. In addition to this, their inner ear is unusual for that of a mammal due to the large trabeculation of the posterior ventral skull between the ears. The tympana of the ear lays almost horizontal and the manubrial tips are separated by a distance of 8 mm. The results of several studies confirms that there is good transmission through European mole’s head for a range of low frequencies. Because of this it is expected that there will be acoustic interaction at each tympanic membrane. The results of the study also suggest that the ears of this mole act as balanced, pressure-difference receivers. This system has never been suggested for a mammal in the past, but other reptiles, amphibia, birds, and crickets have been shown to have a direct air pathway between the tympana.[9]

Skeletal development

In the Talpa europaea there are several unique changes in ossification sequence in the postcranial elements. Many of the shifts are seen in the vertebral column, specifically the cervical and thoracic regions. The shifts allow the mole to have a more stabilized body axis and cervical region after they are born.

After a mole is born and begins to develop it will begin to crawl around and dig. As a result of the constant digging action, elements of the arm and hand that are associated with those movements will begin to ossify. Some elements in the hands of the Talpa, formally described as distal phalanges, are actually the first to ossify. These elements build up a groove for the distal phalanges but ultimately do not fuse with them. These bony elements develop directly, meaning they do not have any cartilaginous precursors. The extra-calcified elements are created from small, calcified particles that are found in the fibrous part of the flexor digitorum profundus. The particles then fuse later in life to form the solid element of the hand. Additionally, the sesamoid bone in the mole, sensu strictu, is a bone that develops within a tendon. It does have a chondrified precursor and it assists the tendon in transmitting force.[10]

Dentition

The variance of morphology between species is very important to paleontologists as it can help define a fossil species. Unlike other characteristics that do not fossilize, like color and karyotype, dentition can be studied as it fossilizes well and varies from species to species. Studying dentition can be very beneficial in recognizing the differences between fossils and subsequently being able to classify them.

The Roman mole, Talpa romana, was once considered a subspecies of the European mole as they are of similar size. The only obvious difference between the two is that the Roman mole has skin-covered eyes and it also has a caecoid pelvis, whereas T. europaea has a europoid pelvis. Although similar in body, the dentition of T. romana is obviously larger in size than that of the European mole. Both the length of the tooth row and the individual elements are larger. Moreover, the mesotyle of the upper molars is generally divided. The dentition of Talpa europaea is small and the length of M1-M3 is less than 19% of the length of the condyle base. This mole also has relatively small molars for its size.[11]

References

  1. ^ Hutterer, R. (2005). In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 308. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Amori, G., Hutterer, R., Mitsain, G., Yigit, N., Kryštufek, B. & Palomo, L.J. (2008). "Talpa europaea". IUCN Red List of Threatened Species. Version 2010.1. International Union for Conservation of Nature. 
  3. ^ Talpa europaea, nomen.at
  4. ^ Mukherjee, Sarah (25 January 2008). "Searching for nature's tunnellers". BBC News. Retrieved 4 May 2010. 
  5. ^ a b Mellanby, K. (1967). "Food and activity in the mole Talpa Europaea". Nature 215 (5106): 1128–30. doi:10.1038/2151128a0. PMID 6061800. 
  6. ^ Funmilayo, O. (1977). "Distribution and abundance of moles (Talpa europaea L.) in relation to physical habitat and food supply". Oecologia 30 (3): 277. doi:10.1007/BF01833635. 
  7. ^ Haeck, J. (1969). "Colonization of the mole (Talpa Europaea L.) in the Ijsselmeer polders". Netherlands Journal of Zoology 19 (2): 145–248. doi:10.1163/002829669X00107. 
  8. ^ Glosmann, M., Steiner, M., Peichl, M., Ahnelt, P.K. (2008). "Cone photoreceptors and potential UV vision in a subterranean insectivore, the European mole". Journal of vision 8 (4): 23.1–12. doi:10.1167/8.4.23. PMID 18484862. 
  9. ^ Coles, R.B., Gower, D.M., Boyd, P.J., and Lewis, D.B. (1982). "Acoustic transmission through the head of the common mole, Talpa europaea". The Journal of experimental biology 101: 337–41. PMID 7166696. 
  10. ^ Prochel, J. (2006). "Early skeletal development in Talpa europaea, the common European mole". Zoological science 23 (5): 427–34. doi:10.2108/zsj.23.427. PMID 16766861. 
  11. ^ Cleef-Roders, J.T., van den Hoek Ostende, L.W. (2001). "Dental morphology of Talpa europaea and Talpa occidentalis (Mammalia: Insectivora) with a discussion of fossil Talpa in the Pleistocene of Europe". Zool. Med. 75: 51–68. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!