Overview

Brief Summary

Biology

The Pyrenean desman seeks shelter in rock crevices, caves, or the burrows of water rats, only rarely digging their own burrows. This species lives in pairs that are typically monogamous, with the male's territory completely encompassing that of the female, although solitary adults also exist (6). Territories are scent-marked and will be defended to the death against intruders (5) (6). The breeding season is from January to May, during which females may breed up to three times (5) (6). Litters of one to five, usually three to four, young are born after a gestation period of about 30 days, and weaning probably takes place after around 30 days (5) (6). Sexual maturity is thought to be attained after approximately two years, but little else is known of the life history patterns of this enigmatic species (5). The Pyrenean desman feeds nocturnally on a diverse array of crustaceans and insect larvae, including stoneflies and caddis fly larvae (1), although this amphibious mammal may also exhibit short periods of activity during the day (3). Ungainly on land (5), this species is a powerful swimmer and accomplished diver, primarily foraging by sifting through stream sediments with its forefeet and using its extremely tactile and sensitive long snout to search for prey (3). It has been suggested that the Pyrenean desman may also slap the surface of the water to produce noises useful in echolocation to help find its way around and locate underwater prey, but this is only speculation (5) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Named after the place of its home, the Pyrenean desman is a small aquatic insectivore closely related to moles, also known as the Iberian desman (4) (5). This adept swimmer has many adaptations to its aquatic habitat, including an elongated head and body with a long tail, webbed, paddle-like hindfeet, and the ability to close both ears and nostrils to prevent water getting in (3) (5) (6). In contrast to moles, which have powerful digging front legs, desmans have powerful hind legs that are longer than the forefeet to help propel them through the water (5). The tail is also slightly flattened vertically, acting as a rudder and helping to steer and direct the animal as it swims (7). A double layer of fine dark greyish-brown fur includes a dense waterproof underfur and oily guard hairs (5). The eyes are tiny and eyesight is poor, but the long, black, almost hairless snout is highly sensitive and used to locate prey (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Pyrenean desman is restricted to the Pyrenees mountains (Andorra, France and Spain), as well as parts of northern and central Spain and northern Portugal. In France it occurs along the Aude, Agly, Salat, Aspe, Ossau, Ariège, Ardour, Tet and Tech rivers. In Portugal it occurs along the Minho, Ancora, Lima, Neiva, Cavado, Ave, Leca, Douro, Vouga, Mondego, and Tejo rivers (Queiroz et al. 1998) In Spain it is found in the upper reaches of rivers in the Pyrenees, the Cantabrian mountains, the Sistema Central, the Picos de Europa and along the Deva River. It also occurs in the Sierra de Guarra north of Huesca and Infiesta, Oviedo, and Burguete, Navarro (J. Herrero pers. comm. 2006). It is found at altitudes between sea level and 2,500 m (Palomo and Gisbert 2002). In Spain, the river systems that the species occurs in flow to three different seas: Mediterranean, Atlantic and Cantabrian; hence the populations are all separated from each other.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Pyrenees mountains in France, and the northern portion of the Iberian peninsula (Spain and Portugal)

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Known from the Pyrenees Mountains and the northern Iberian Peninsula in the countries of France, Spain and Portugal (1) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Iberian desmans have many adaptations to their aquatic habitat. These include a long tail, verticaly flattened at the end, and the ability to close their ears and nostrils.

Average mass: 57.5 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The desman's preferred habitat is fast flowing mountain streams, although it is occasionally found in slow moving water bodies such as canals, lakes and marshes. It favours perennial rivers where the margins offer some shelter, and it requires clean and well oxygenated water. G. pyrenaicus is specialised to an aquatic environment. It feeds nocturnally on a diverse array of crustaceans and insect larvae, including stoneflies and caddis fly larvae (Queiroz 1999, Palomo and Gisbert 2002, Cabral et al. 2005).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Iberian desmans are usually found in cold mountain lakes and rivers with abundant crustaceans and insect larvae.

Terrestrial Biomes: forest ; mountains

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Unlike the only other desman species, the Russian desman (Desmana moschata), the Pyrenean species lives along fast-flowing mountain streams, although it is occasionally found in slower-moving water bodies, including canals, lakes and marshes at altitudes of 60 to 1,200 metres (1) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Iberian desmans eat larval aquatic insects, crustaceans, and terrestrial insects. They will eat appropriate food whether it is alive or dead. Some people have claimed that Iberian desmans forage away from water, but this is uncertain.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
3.5 years.

Average lifespan

Status: wild:
4.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild, these animals have been estimated to live up to 4 years (Bernhard Grzimek 1990). It is possible, albeit unknown, that they live much longer in captivity.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The gestation period is about thirty days. Populations have three estrus peaks in a given breeding season (January-May). Litter size can be from one to five. Sexual maturity is reached in the second year of life.

Average gestation period: 30 days.

Average number of offspring: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Galemys pyrenaicus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0383-06|AY833419|Galemys pyrenaicus| AATCGCTGACTATTCTCAACTAATCATAAGGACATCGGCACATTATATCTTTTATTTGGTGCCTGAGCTGGTATGGTGGGAACTGCCCTA---AGTCTGTTAATTCGAGCTGAGTGGGGGCAACCAGGAAGCCTCTTAGGGGAT---GACCAAATTTATAATGTAATTGTCACAGCTCACGCCTTTGTAATAATTTTCTTTATAGTTATACCAATTCTATTAGGAGGGTTCGGCAACTGACTCGTTCCTCTAATA---ATTGGCGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTCTGATTATTACCACCATCATTCTTACTTCTAATAGCTTCTTCAACTGTTGAAGCAGGTGCAGGAACTGGATGAACTGTTTACCCCCCTCTAGCTGGTAACTTAGCCCACGCAGGAGCCTCAGTTGATTTA---GCAATCTTCTCGCTACACCTAGCAGGAGTATCATCTATCCTAGGGGCTATTAACTTCATTACTACCATTATTAATATAAAACCACCTGCAATCTCCCAATACCAGACACCACTGTTTGTGTGATCTATTTTAATTACAGCTGTCTTACTACTTCTTTCTCTCCCTGTACTAGCAGCT---GGTATTACAATATTACTAACAGACCGAAATCTAAATACTACTTTTTTTGACCCTGCTGGAGGAGGAGACCCTATTTTATACCAACACTTATTTTGATTCTTTGGACACCCTGAAGTATATATTTTAATCCTCCCAGGATTTGGAATCATTTCACACATCGTTACGTACTACTCAGGAAAAAAA---GAACCTTTCGGATATATGGGTATAGTATGAGCTATAATATCTATTGGGTTCTTAGGATTCATTGTTTGAGCTCATCACATGTTTACAGTTGGCCTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Galemys pyrenaicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2ac+3c+4ac

Version
3.1

Year Assessed
2008

Assessor/s
Fernandes, M., Herrero, J., Aulagnier, S. & Amori, G.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Vulnerable because the species is undergoing declines across its whole range. Declines appear to be the highest in Spain, but are lower in France (where the population marginally occurs) and Portugal. An overall decline of 30% over the last ten years is plausible, and given the ongoing threats to this species it is realistic to expect a further decline of at least 30% over the next ten years.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

IUCN "vulnerable" due to habitat destruction

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population has declined in recent years, but it is hard to obtain precise estimates of population size and decline rate for this shy and secretive species (González-Esteban et al. 2003). The desman has been radio-tracked in Portugal following successful capture of animals using underwater traps (care is required to check these traps regularly to prevent drownings: M. Fernandes pers. comm. 2006). In favourable habitats population densities may be 5-10 individuals per kilometre, but other studies indicate much lower densities (Quaresma et al. 1998, Chora 2001, Cabral et al. 2005). In Portugal it is estimated that there are less than 10,000 mature individuals divided into small and isolated subpopulations due to the existence of physical (e.g. dams) and ecological barriers (Cabral et al. 2005). In Spain the species has undergone marked declines in the central system (J. Herrero pers. comm. 2006), and the desman has disappeared from some sites where it was previously known (Palomo and Gisbert 2002). In the Spanish Pyrenees and Cantabrian regions densities range from 2.8 to 7.3 animals per km of river (Palomo and Gisbert 2002); however, in the Sistema Central population densities are lower (P. García pers. comm. 2007). In France the population is also declining (S. Aulagnier pers. comm. 2006).

As well as population declines, range contractions have been observed along the western, southern, and eastern edges of the desman's range in Portugal (Cabral et al. 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is confined to a very vulnerable habitat in a restricted area. The most potent threats are from water pollution, and habitat fragmentation caused by the construction of hydro-electric plants, water extraction, and dam and reservoir construction (Queiroz 1999, Palomo and Gisbert 2002, Cabral et al. 2005). Other threats are direct persecution from fishermen who incorrectly believe this species to be a threat to fish stocks, especially trout, or from over-eager collectors. Poison and explosives are used as fishing methods in Portugal, which would kill the desman (Cabral et al. 2005). The escape of North American mink (Neovison vison) from fur farms in northern Iberia might be negatively impacting populations in Galicia. It is predated by otters in Galicia (forming up to 5% of their diet) (Palomo and Gisbert 2002).

Climate change is anticipated to be a serious threat to the desman in the near future. The species tends to occur only in areas with annual rainfall superior to 1,000 mm and, given climate change scenarios for Spain, by 2060 the species may be virtually extinct from central Spain and also in most of its important areas from northern Iberia (P. García pers. comm. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The Pyrenean desman is threatened because it is bound to a very vulnerable habitat within a restricted area. The greatest threat to the species comes from water pollution and habitat fragmentation caused by the construction of hydroelectric plants. Direct persecution from fishermen who mistakenly believe the species competes for fish stocks, especially trout, also poses a threat, as does over harvesting from the wild by eager collectors. In addition, fears have been expressed that North American minx (Mustela vison) escaping from fur farms in northern Iberia may be having a negative impact upon populations. The full impact of these threats is not known as population surveys are notoriously difficult for this aquatic species (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is strictly protected under the Bern Convention (Appendix II) and the EU Habitats and Species Directive (Annexes II and IV). Part of the range falls within the Parc National des Pyrénées Occidentales and Parque Nacional de Covadona, and possibly the Parque Nacional de Aiguas y Lago de San Mauricio and the Parque Nacional de Ordesa. This species' conservation has been the topic of an international conference that has drawn up an action plan that includes priority actions. There is also an action plan for the species in Portugal. Actions proposed include appropriate management of water courses, habitat restoration, improvement of knowledge of the threatened populations, and use of the desman as a flagship species to promote river conservation (Cabral et al. 2005). In Spain the species is considered Vulnerable because populations have disappeared from the formerly known range (L.J.P. Muñoz pers. comm. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Pyrenean desman and its dwindling habitat are protected in the parts of its range that occur within the Parc National des Pyrénées Occidentales and Parque Nacional de Covadona, and populations may also possibly exist in the Parque Nacional de Aiguas y Lago de San Mauricio and the Parque Nacional de Ordesa. Following an international conference on the conservation of this rare aquatic mammal, an action plan was drawn up to help save the species from further declines (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pyrenean Desman

The Pyrenean Desman (Galemys pyrenaicus) is a small semi-aquatic mammal that lives in the Pyrenees to the Iberian peninsula. The Pyrenean Desman is in the monotypic genus Galemys.[1] The Pyrenean Desman lives in mountain streams.[3]

This desman lives in pairs. It is 11 to 16 centimetres (4.3 to 6.3 in) long with a tail of 12 to 16 centimetres (4.7 to 6.3 in). It weighs 35 to 80 grams (1.2 to 2.8 oz). The Pyrenean Desman can live at least 3.5 years.

References

  1. ^ a b Hutterer, Rainer (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M.. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 303. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ Insectivore Specialist Group (1996). Galemys pyrenaicus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 2006-05-11. Listed as Vulnerable (VU B1+2c v2.3)
  3. ^ http://www.bbc.co.uk/nature/wildfacts/factfiles/599.shtml
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!