Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Dutch (1) (learn more)

Overview

Brief Summary

European water shrews are good at swimming, diving and climbing. They dig tunnels in banks, which is why they live in wet regions with lots of vegetation. In their search for food, they often hang sideways while they turn over stones to find aquatic insects. European water shrews are very noisy animals. They can make whistling sounds, trills and high shrieking and shushing noises. At the same time, they are very shy and can be literally scared to death.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

This largely nocturnal species (5) inhabits burrows during the day and emerges to feed on invertebrates at night (2). They dive under water to obtain prey such as freshwater shrimps and caddis fly larvae, and the occasional frog newt or small fish may be tackled (2). When diving, the water-resistant fur holds bubbles of air that give the shrew a silvery appearance (4). They can also hunt on land for worms, beetles and other terrestrial invertebrates (4). Shrews are well known for their voracious appetites; water shrews must eat about half their own body weight in food every 24-hours to stay alive (6). Unusually amongst mammals, this species has venomous saliva, which aids in stunning prey (2). This species frequently grooms itself carefully, especially after diving. Water is removed by shaking and scratching, and also by squeezing through their narrow burrows (6). Water shrews are solitary animals, and hold territories (2). They do not hibernate, but are active throughout the year (2). Breeding takes place between April and September (5); during this time 1 or 2, but occasionally 3 litters of 3-15 young are produced in a nest of woven grasses (2) after a gestation period of 14-21 days (4). The lifespan is short (between 14 and 19 months); adults die after breeding, and the young breed the following year (2). Predators include tawny owls, barn owls, foxes, predatory fish and kestrels (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The water shrew is the largest of the British shrews (2); it has black upper parts and a whitish underside, between which there is a clear demarcation (4). Typically for most shrews, the snout is long and the eyes and ears are small (2). The fur is short and dense, and there are often tufts of white around the eyes and on the ears (2). Stiff hairs border the feet and form a keel on the underside of the tail (2), which aid in swimming (4). This species is a 'red-toothed shrew'; iron is deposited in the enamel of the tooth-tips, making them more resistant to wear-and-tear, and giving them a red appearance (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The water shrew has a large range extending from the British Islands eastwards to Lake Baikal, Yenisei River (Russia), Tien Shan (China), and northwest Mongolia. In the Mediterranean is ranges from northern Spain eastwards to Bulgaria.In Europe it is generally widespread throughout, with the exception of southern Iberia. It occurs only sporadically on the Balkan peninsula, where it is largely restricted to the mountains. It occurs from sea level to over 2,500 m (Stone 1995). The distribution of the species recently expanded southwards in Italy owing to a new record in the Sila massif (Aloise et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Neomys fodiens occurs throughout Eurasia, to western Siberia, northern Asia Minor, the Pacific coast of Siberia, and North Korea.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurring throughout much of continental Europe, water shrews have a wide distribution in England, are quite common in Wales but rare in areas of northern and western Scotland (5). It is also found on several large offshore islands, including the Isle of Wight, Anglesey, Skye, Mull and Arran. It is absent from Ireland, the Channel Islands and the Scillies (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

A darkly colored shrew with a white underside. Coloration on dorsal and ventral sides are sharply demarcated. A fringe of bristles runs along the ventral surface of the tail and on the paws which are thought to serve as a swimming aid. Teeth have red tips. Females have five pairs of mammae.

Average mass: 15 g.

Average basal metabolic rate: 0.328 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Neomys fodiens
Catalog Number: USNM 101311
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): R. Young
Year Collected: 1899
Locality: Montrejeau, Haute-Garonne Department, Midi-Pyrenees, France, Europe
  • Type: Miller, G. S. 1901 Apr 25. Proceedings of the Biological Society of Washington. 14: 45.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is semi-aquatic with water repelling fur. It occurs in a wide variety of wetland habitats, both freshwater and coastal, including lakes, rivers, streams, marshes, bogs, damp grasslands, humid woodlands, sea shores and intertidal wetlands. It is the most aquatic of all European shrews. It hunts on land and in water for invertebrates, including crustaceans, and occasionally takes small fish and amphibia (Sokolov and Orlov 1980, Spitzenberger 1999, Smith and Xie in press). It paralyses large prey with its venomous saliva (Stone 1995, Smith and Xie in press). It is highly territorial, with males only moving out of territory during the breeding season.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found on the banks of both standing or flowing fresh water and adjacent areas.

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This semi-aquatic species is found close to water, in stream banks, ponds, rivers, reed-beds and fens, with a particular preference for watercress beds (2). However, it may also occur away from water in damp woodlands (4), and hedgerows (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

These shrews forage almost exclusively underwater, efficiently preying on aquatic invertebrates such as snails, mollusks, freshwater insects, and also small vertebrates such as fish, amphibians and frogs. Prey are weakened by a poisonous secretion from the submaxillary gland. They generally forage by taking a dive that can last up to 20 seconds. After coming onto land, water shrews quickly run into their burrows and emerge a moment later almost dry, after coming through the tight squeeze of the tunnel where the water is absorbed by the soil. The process is then repeated a few meters away along the stream bank. Water shrews are also known to eat some terrestrial insects as well, such as dipteran larvae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
3.0 years.

Average lifespan

Status: captivity:
1.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 3.1 years (captivity) Observations: Unverified reports, which appear plausible, suggest that these animals may live up to 3.1 years of age in captivity, though they rarely live more than 1 year in the wild (http://members.chello.at/natura/shrew/index.html).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The breeding season in England occurs fom April to September, with multiple litters per season. Litter size can be between 3 and 12, more commonly 5 or 6. Gestation lasts approximately 20 days, and lactation twice that. Sexual maturity is reached between 6 and 8 months.

Average birth mass: 0.78 g.

Average gestation period: 20 days.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (male)

Sex: male:
106 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
106 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neomys fodiens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CGAATAAATAATATAAGCTTTTGACTGCTTCCCCCATCTTTTCTTCTACTTTTAGCTTCATCTACTGTTGAAGCAGGTGCAGGCACTGGATGGACAGTTTATCCCCCATTAGCCGGAAACCTCGCCCATGCAGGAGCATCGGTAGACCTAGCAATTTTCTCCCTTCACTTGGCCGGAGTCTCTTCAATTTTAGGCTCAATTAATTTCATCACAACGATTATCAACATAAAACCCCCAGCCATGTCCCAATATCAAACTCCCCTTTTCGTATGATCCGTCCTAATCACAGCTGTATTACTACTTTTATCACTTCCAGTTTTAGCTGCCGGTATTACTATATTACTTACAGATCGTAACCTGAACACTACTTTCTTTGACCCAGCCGGAGGTGGTGACCCCATCCTATATCAACATCTCTTCTGATTCTTTGGCCACCCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neomys fodiens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutterer, R., Meinig, H., Bertolino, S., Kryštufek, B., Amori, A., Sheftel, B., Stubbe, M., Samiya, R., Ariunbold, J., Buuveibaatar, V., Dorjderem, S., Monkhzul, Ts., Otgonbaatar, M. & Tsogbadrakh, M.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
This species has a wide range and is generally abundant, although local population declines have been recorded. Loss and degradation of wetland habitat is the main threat, although this is not a serious threat to the global population at present. Assessed globally as Least Concern. The subspecies niethammeri in western Spain has a restricted range and may be threatened. It is morphologically distinct from other populations and may warrant species status. Further taxonomic investigation and population monitoring is recommended for this subspecies.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Quite common within its geographical range.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Partially protected in the UK under Schedule 6 of the Wildlife and Countryside Act, 1981 (3). Listed under Schedule III of the Bern Convention, and classified as a Species of Conservation Concern under the UK Biodiversity Action Plan, although not a priority species (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a widespread species, although local population declines may be caused by wetland drainage, pollution, and destruction of riverbanks. Population densities fluctuate from year to year (Spitzenberger 1999). In the northern part of its range and in the steppe zone, the species has a patchy distribution.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Loss of wetland habitats through drainage, development, conversion to agricultural land, and destruction of natural vegetation at the water's edge may have a negative impact on this species. It may suffer from a shortage of food when prey species decline owing to acidification and pollution of water with pesticides, fertilisers, and sewage (Spitzenberger 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Drainage schemes (2) and the modification of riverbanks and riparian vegetation resulting from river engineering and agricultural intensification are likely threats (5). As this species is at the top of a semi-aquatic food chain, it may be highly susceptible to the effects of agrochemicals. Furthermore, any contaminants entering the water can reduce prey availability (5). Loss of continuous hedgerows and a decline in hedgerow quality may also be a problem, as for many species of mammal (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on Appendix III of the Bern Convention, and occurs in numerous protected areas within its range. The western Spanish population is a separate subspecies (niethammeri), which has a very restricted range and may be threatened. It is morphologically distinct from other populations, and may represent a valid species (López-Fuster et al. 1990, Bühler 1996). There is a need for taxonomic research on this population, as well as surveys and monitoring to determine if it is undergoing population decline or range contractions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Water shrews are never very abundant (2), and their populations have a patchy distribution and are short-lived (5); it is therefore very difficult to detect whether the species is threatened (2). Schedule 6 of the Wildlife and Countryside Act protects all shrews from trapping without a licence (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No negative impacts known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

These shrews eat the larvae of insects which some humans find bothersome.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian water shrew

The Eurasian water shrew, Neomys fodiens, known in the United Kingdom as the water shrew, is a relatively large shrew, up to 10 cm (4 in) long, with a tail up to three-quarters as long again. It has short, dark fur, often with a few white tufts, a white belly, and a few stiff hairs around the feet and tail. It lives close to fresh water, hunting aquatic prey in the water and nearby. Its fur traps bubbles of air in the water which greatly aids its buoyancy, but requires it to anchor itself to remain underwater for more than the briefest of dives.

Like many shrews, the water shrew has venomous saliva, making it one of the few venomous mammals, although it is not able to puncture the skin of large animals such as humans. Highly territorial, it lives a solitary life and is found throughout the northern part of Europe and Asia, from Britain to Korea.

Description[edit]

The Eurasian water shrew grows to a length of about 10 cm (4 in) long with a tail length of 8 cm (3 in) and weight of 15 to 19 grams (0.53 to 0.67 oz). The dense short fur on the head, back and sides is greyish-black. The underparts are dirty white and are sharply demarcated from the dorsal surface. Sometimes they are tinged with rusty brown or occasionally are entirely dark grey. There is a white spot just behind the eye and often another near the small, rounded ear which is nearly hidden in the fur. The nose is black and the snout long and tapering.[3] The sharp, mostly white teeth are tipped with red, typical of the shrew subfamily Soricinae. The rusty colour comes from deposits of iron which serve to harden the enamel and which are concentrated in the tips of the teeth, particularly the molars which are the teeth most subject to wear.[4] The female has five pairs of nipples. The legs are short and the hind feet are powerful, with a fringe of short, stiff hairs on the outer edge, both of which features assist while it is driving its body through the water. The tail is slender and has a keel of short white hairs on the underside.[3] This shrew often utters shrill cries as it scurries about.[3]

Its karyotype has 2n = 52 and FN = 98.[1]

Distribution and habitat[edit]

The Eurasian water shrew is found throughout Europe with the exception of Iceland, Ireland, The Iberian Peninsula, certain Mediterranean islands and the Balkans.[3] In Asia, its range extends from western Siberia ans Asia Minor to North Korea and the Pacific coast of Siberia.[5] It rarely strays far from water and is found in and around ditches, streams, ponds, watercress beds, fish ponds, damp meadows and rough bushy ground adjoining water.[3]

Biology[edit]

Outside the breeding season, both male and female Eurasian water shrews maintain a territory but during the breeding season, only the females do so. At this time the males wander about visiting various female territories which indicates a promiscuous mating system without pair bonding.[6] On the whole they are solitary animals that seem to mutually avoid each other and there is no social hierarchy.[5]

The breeding season extends from April to September and much of the courtship takes place in the water. It either uses pre-existing burrows or digs its own. The nesting chamber is lined with moss, dry grass and leaves. Litters of four to eight or more young are born after a twenty four day gestation period. The young are tiny and helpless at birth. Their eyes open at fifteen to eighteen days and they are fully weaned at about seven weeks. Females can produce two or three litters a year.[3] The juveniles disperse after weaning, setting up their own territories.[6] They are sexually mature at six to eight months and their life expectancy is about three years.[5]

The Eurasian water shrew is active both night and day and is thoroughly at home in the water. Its short fur holds air and the skin does not get wet when it swims. When it emerges from the water it enters one of its many burrows and any moisture adhering to the fur is absorbed by the earth walls. It mostly feeds on aquatic organisms which are caught while it is swimming. It can remain underwater for twenty seconds before it has to surface to breathe. Larger prey items can be subdued by the toxic secretions from its submaxillary glands. They feed on crayfish, water snails, small fish, aquatic larvae, insects, spiders, amphibians, especially newts and small rodents are also eaten. It also feeds on land on such things as insect larvae.[5]

The Eurasian water shrew has a pair of glands under its jaw which produce venom, and this has been shown to be potent against the field vole (Microtus agrestis), and lethal at a minimum dose of fifteen milligrams per kilogram body weight.[7] The venom consists of a paralytic peptide which has been patented for use in neuromuscular therapy.[8]

Status[edit]

The International Union for Conservation of Nature lists the Eurasian water shrew as being of "Least concern" in its Red List of Threatened Species. This is because it has a large population distributed across a wide range and its population seems fairly stable. In some areas habitat degradation is occurring and wetlands are being drained but not to such an extent as to increase the status to "Vulnerable". Other possible threats include agricultural products and sewage which may pollute waterways and reduce the availability of food. In western Spain, a separate subspecies (N. f. niethammeri) has a very limited range and may be declining in numbers.[2]

References[edit]

  1. ^ a b Hutterer, R. (2005). "Order Soricomorpha". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 279. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b Hutterer, R., Meinig, H., Bertolino, S., Kryštufek, B., Amori, A., Sheftel, B., Stubbe, M., Samiya, R., Ariunbold, J., Buuveibaatar, V., Dorjderem, S., Monkhzul, Ts., Otgonbaatar, M. & Tsogbadrakh, M. (2008). "Neomys fodiens". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 2013-09-14. 
  3. ^ a b c d e f Konig, Claus (1973). Mammals. Collins & Co. pp. 23–26. ISBN 978-0-00-212080-7. 
  4. ^ Strait, S. G.; Smith, S. C. (2006). "Elemental analysis of soricine enamel: pigmentation variation and distribution in molars of Blarina brevicauda". Journal of Mammalogy 87 (4): 700–705. doi:10.1644/05-MAMM-A-265R4.1. 
  5. ^ a b c d Fahey, Bridget (1999). "Neomys fodiens: Eurasian water shrew". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 30 August 2013. 
  6. ^ a b Cantoni, Debora (1993). "Social and spatial organization of free-ranging shrews, Sorex coronatus and Neomys fodiens (Insectivora, Mammalia)". Animal Behaviour 45 (5): 975–995. doi:10.1006/anbe.1993.1116. 
  7. ^ Dufton, Mark J. (1992). "Venomous mammals". Pharmacology & Therapeutics 53 (2): 199–215. doi:10.1016/0163-7258(92)90009-O. 
  8. ^ "Patent: Paralytic peptide for use in neuromuscular therapy". Patent 7485622. United States Patent Office. 3 February 2009. Retrieved 30 August 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!