Overview

Distribution

Range Description

The Moonrat occurs in the Sundaic region of Indonesia, Malaysia, Brunei, southern Thailand and southern Myanmar. It can be found throughout Borneo (Brunei, Kalimantan, Sabah and Sarawak), Labuan island (off Sabah), Sumatra, Tebingtinggi island (off the east coast of Sumatra), Peninsular Malaysia, Peninsular Thailand south of 12ºN, and extreme southern Myanmar (Corbet 1988). It has not been reported from Singapore, though it might once have occurred there. It occurs from sea-level up to at least 1,000 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Echinosorex gymnurus is found on the Malay Peninsula south of about 12 N and also on Borneo and Sumatra.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The coarse hair of moon rats is white on the head and distal part of the tail and is black elsewhere. The hair on the scaly tail is sparse. The face has black spots near the eyes. White forms are known. The long, mobile nose has a groove on its underside from the tip to a point between the upper incisors. The body is long and narrow. The canines are larger than the adjacent teeth. Head and body length ranges from 260 to 460 mm and females tend to be larger than males.

Range mass: 0.5 to 1.4 kg.

Average basal metabolic rate: 2.816 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Moonrat prefers primary and secondary lowland forests, including very moist areas such as mangroves and swamp forests. It is also found in hilly forests. The species can also tolerate a certain degree of habitat modification, and can be found in rubber plantations and other cultivated areas. According to Lekagul and McNeely (1977), moonrats prefers wet areas and often enters water.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The habitat of moon rats is primary and secondary lowland forest, mangrove swamps, rubber plantations and other cultivated areas. They seem to prefer moist areas, often near streams, with thick ground vegetation.

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet if the gymnure is varied, though there is some debate about what food items are most important. It seems that the main component of the diet is terrestrial and aquatic invertebrates such as earthworms, insects, spiders, scorpions, centipedes, millipedes, crabs and molluscs. Some aquatic vertebrates like frogs and fish are also eaten, as well as fruit.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals. There have been, so far unverified, claims of animals living up to 7 years (Ronald Nowak and John Paradiso 1983). One captive specimen was estimated to be 5.2 years old when it died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Breeding occurs throughout the year. Two litters per year, each averaging two young, is typical. Gestation is usually betwen 35 and 40 days.

Average birth mass: 14.5 g.

Average gestation period: 37 days.

Average number of offspring: 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echinosorex gymnura

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0560-06|NC_002808|Echinosorex gymnura| AACCGTTGACTATTTTCTACTAATCATAAAGATATCGGAACTTTATATATAATTTTTGGTGCTTGAGCCGGTATGGCAGGAACGTCTCTC---AGTCTGCTTATTCGAGCTGAACTTGGTCAACCAGGAGCCCTACTTGGAGAT---GACCAAATCTACAATGTAGTAGTAACTGCTCACGCTTTTATCATAATTTTCTTTATAGTTATACCTATCATATTAGGAGGATTCGGAAATTGACTAGTACCCTTAATA---ATTGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGCTTTTGACTATTACCCCCATCTTTCCTATTACTATTAGCTTCATCCATAGTTGAAGCAGGAGCAGGAACAGGATGAACAGTTTACCCCCCATTAGCAGGAAATCTAGCGCATGCAGGAGCATCAGTTGACCTA---GCCATTTTTTCTCTTCATCTCGCAGGAGTATCATCAATCCTCGGCGCTATTAATTTTATTACAACAATTATTAACATAAAACCCCCAGCATTAACACAATATCAAACACCATTATTTGTATGATCTATTCTAATTACAGCTGTCCTATTACTATTATCTCTTCCAGTTCTTGCTGCT---GGCATTACTATATTATTAACAGACCGTAATCTAAATACTACTTTTTTTGACCCTGCAGGGGGCGGAGACCCAATTCTATATCAACATCTATTCTGATTCTTTGGCCACCCAGAAGTGTATATTCTAATTTTACCAGGCTTTGGTATTATCTCCCATATTGTAACATACTATTCAGGAAAAAAA---GAACCATTTGGTTATATAGGAATAGTGTGAGCTATAATATCAATTGGATTCCTAGGATTTATTGTATGAGCGCATCATATATTCACAGTAGGTTTAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Echinosorex gymnura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Lunde, D., Meijaard, E., Ruedas, L. & van Strien, N.J.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chiozza, F. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in view of its wide distribution, its abundance in suitable habitat, and because it is unlikely to be declining at anything close to the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Echinosorex gymnurus does not appear to be threatened currently.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population size of this species is not known, but it is believed to be relatively common in sutable locations.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Serious forest loss is taking place through much of the range of this species, especially at lower elevations. In particular, forest in being cleared for oil palm plantations, and forests are being burnt in many places. Although these large-scale changes must be having an impact on the species, it is relatively adaptable, and so is probably not seriously threatened at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is present in many protected areas. Further studies are needed into the taxonomy, distribution, and abundance of this species. If it is shown to comprise several species, it is possible that some of these might prove to be threatened. Research should be carried out to determine whether or not this species can survive in large-scale oil-palm plantations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Moonrat

The moonrat (Echinosorex gymnura) is a species of mammal in the Erinaceidae family. It is the only species in the genus Echinosorex. The species name is sometimes given as E. gymnurus, but this is incorrect.[1]

The moonrat has a distinct pungent odour with strong ammonia content, different from the musky smell of carnivores.[3] There are two subspecies: E. g. gymnura is found in Sumatra and the Thai-Malay Peninsula; E. g. alba is found in Borneo.[4] In the former the head and frontal half of the body are white or grey-white; the remaining is mainly black.[5] The latter subspecies is generally white (alba means white in Latin), with a sparse scattering of black hairs; it appears totally white from a distance. Those from western Borneo tend to have a greater proportion of black hairs than those from the east, but animals from Brunei appear intermediate.[4] Largely white E. g. gymnura also occur, but they are rare.[5]

Head and body length is 320–400 mm, tail length is 205–290 mm, hind foot length is 65–75 mm and weight is 87-–1,100 g.[5] The dental formula is Upper: 3.1.4.3, lower: 3.1.4.3, total: 44.[4]

Contents

Distribution

Moonrats inhabit most jungle terrain in southern Myanmar, Peninsular Thailand, Peninsular Malaysia, Borneo and Sumatra. Although they are closely related to the short-tailed gymnure (Hylomys suillus) and to the hedgehog, full grown specimens more closely resemble large rats, with which they share similar habits and ecological niches.[6] In Borneo, they occur at many sites throughout the lowlands and up to 900 m in the Kelabit Highlands. They appear to be absent or rare in some localities, possibly due to a shortage of suitable food.

Ecology and habitat

Moonrats are nocturnal and terrestrial, lying up under logs, roots or in abandoned burrows during the day. They inhabit moist forests including mangrove and swamp forests and often enter water.[5][2] In Borneo, they occur mainly in forests, but in peninsular Malaysia they are also found in gardens and plantations. They feed on earthworms and various small animals, mostly arthropods.

Behavior and reproduction

Moonrats release strong odours with a strong ammonia content to mark the edges of their territories and warn other moonrats to stay away with threatening hisses also to ward off predators. Adults live alone. When they are preparing to have young, they will make nests mostly from leaves. Females usually have two babies at one time.

Diet

The moonrat is quite an omnivore, known to eat a wide range of invertebrates—for example, worms, insects, crabs and other invertebrates found in moist areas. They will also eat fruit, and occasionally frogs or fish.

Lifespan

The lifespan of the moonrat is up to five years.[7][dead link]

Conservation status

The moonrat is not considered a threatened species. The main threat to the moonrat is deforestation activities due to human development for agriculture, plantation, and commercial logging. Moreover, other demands from Penan in Borneo for food and traditional medicinal contribute to decreasing numbers of moonrats in Borneo.[6] The species is also found in protected areas, including Matang National Park and Kuching Wetlands National Park. Its IUCN status is Least Concern.[2]

Economic importance

In the United States of America, members of the family Erinaceidae are commonly kept as pets. The Penan in Borneo used to trade moonrat meat for other foods and goods among themselves and for money.[7][dead link]

References

  1. ^ a b Hutterer, Rainer (16 November 2005). "Order Erinaceomorpha (pp. 212-219)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 218. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=13600055. 
  2. ^ a b c Lunde, D., Meijaard, E., Ruedas, L. & van Strien, N.J. (2008). "Echinosorex gymnura". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/40603/0. Retrieved 6 April 2011. 
  3. ^ Moonrat at Encyclopædia Britannica
  4. ^ a b c Payne, J. and Francis, C. M. 2005. A Field Guide to the Mammals of Borneo. Sabah society, Malaysia
  5. ^ a b c d Francis, C.M. (2008). A field guide to the mammals of South-East Asia. New Holland Publishers (UK) Ltd. pp. 176. ISBN 978-1-84537-735-9. http://books.google.co.uk/books?id=zWeS8A6nunIC&pg=176. Retrieved 2011-04-06. 
  6. ^ a b http://www.thewebsiteofeverything.com/animals/mammals/Insectivora/Erinaceidae/
  7. ^ a b http://www.americazoo.com/goto/index/mammals/39.htm
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!