Overview

Comprehensive Description

Description

The long-eared hedgehog is a small and rather pale hedgehog, with short spines covering the upperparts of the body. Like other hedgehogs, these stiff spines, which are brown at the base and white at the tips, act as effective armour when the hedgehog rolls into a protective ball. The legs, feet and underparts are also whitish, the latter of which may be tinged with yellow. The long-eared hedgehog has a pale brown face, with a long, pointed snout and large, rounded ears, which appear somewhat whitish and translucent. The tail is short, but the legs are relatively long, which is particularly apparent when the hedgehog is trotting. The long-eared hedgehog produces a variety of vocalizations, including a snuffle, a cat-like hiss, and a growl when threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Hemiechinus auritus has a global range that extends from the eastern Mediterranean region, through southwest Asia to western Pakistan in the south; and from eastern Ukraine through Mongolia (Gobi desert), to China (Xinjiang).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Hemiechinus auritus inhabits Egypt, Asia Minor, Afghanistan, parts of India, Russian Turkestan, southeastern Russia, Chinese Turkestan, and Mongolia.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

88 records. Latest in 2001 (west of Matruh)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Widespread. AOO=302.4 km². EOO=136524.5 km². 9 locations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread (steppe zone from Ukraine to Mongolia in the north and from Libya to W Pakistan in the south).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Length of the head and body of Hemiechinus auritus is approximately 120-270mm, and the tail is 10-50mm long. The spines are banded with dark brown and white, and the underparts of the hedgehog are whitish. The ears are much larger than those of other hedgehogs (longer than half the length of it head) and are considered a development for heat radiation in the desert. Long-eared desert hedgehogs also have acute senses of hearing and smell, which they use to locate food and detect predators

Average mass: 342 g.

Average basal metabolic rate: 0.845 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length 14–21 cm, weight 300 gm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Taxonomy

Two ssp recognised by Osborn & Helmy (1980), libycus Ehrenberg along the Mediterranean coast, and aegyptius Geoffroy in North Sinai and the Nile Delta to Faiyum.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
H. auritus inhabits different types of dry steppes, semi-deserts and deserts. It prefers dry river valleys, gullies, forest shelter belts, abandoned irrigation ditches and shrubby areas, and often settles in oases and around human settlements (sometimes in cultivated habitats). It avoids tugais and high herbage.

This mainly solitary, nocturnal species lives in burrows that it usually digs itself, although sometimes it occupies abandoned burrows of turtles, gerbils, foxes and otters. It hibernates in the winter and may also aestivate in hot, dry weather.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Hemiechinus auritus are found in arid deserts and steppes, and they commonly burrow under small bushes. They may also rest by day under rocks, rock heaps or hollows.

Terrestrial Biomes: desert or dune ; chaparral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The long-eared hedgehog is commonly found inhabiting sub-desert areas or semi-arid grass-covered plains, also known as steppe. It has recently become more closely associated with humans and is commonly found in gardens and other urban green areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The long-eared desert hedgehog is omnivorous but feeds mainly on small invertebrates and insects. Favorite foods include grasshoppers, beetles, and other insects. They also consume eggs, fruit, vegetables and even small vertebrates such as lizards and snakes. They are remarkably resistant to scarcity of food and water; in the laboratory they have survived as long as ten weeks without food and water.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

A nocturnal animal, the long-eared hedgehog may wander up to nine kilometers at night in search of food. It has a varied diet, including insects, small vertebrates, eggs, fruit, seeds and carrion, but, incredibly, this mammal is also able to survive without food or water for up to ten weeks.

The long-eared hedgehog spends the daytime in a burrow, either an existing burrow dug by another animal, or one that has been dug by the hedgehog. Measuring up to 150 centimeters deep, these burrows are frequently found beneath small bushes and possess only one opening, with a single individual inhabiting each burrow. However, these burrows are expanded during the breeding season to ensure ample space for the young.

The long-eared hedgehog generally only breeds once a year, usually between the months of July and September, during which time the female gives birth to a litter of one to four offspring after a gestation period of 35 to 42 days. The offspring are born almost completely naked apart from the odd spine which is initially very soft. These spines grow rapidly and just five hours after birth may have almost quadrupled in size. The young open their eyes one week after birth, and after just two weeks the young are fully covered with spines. Able to eat solid food three weeks after birth, the young are weaned after about one month and are sexually mature at just six weeks old. The long-eared hedgehog has been recorded living for over six years in captivity.

 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
6.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.6 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Hemiechinus auritus breeds only once a year, generally between July and September, and females have between 1-4 offspring per litter. Gestation is 35-42 days; the young's eyes open after one week, and baby hedgehogs eat solid food after three weeks. Baby hedgehogs are born naked except for sparsely scattered spines, which are very soft. The spines quadruple in length within 5 hours after birth and after 2 weeks, the babies are fully covered with them. Very little is known about their life cycle (such as weaning, age at sexual maturity or life span in the wild).

Average birth mass: 10 g.

Average gestation period: 39 days.

Average number of offspring: 4.

Average age at sexual or reproductive maturity (female)

Sex: female:
213 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemiechinus auritus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0587-06|NC_005033|Hemiechinus auritus| TCTCGCTGACTTTTCTCTACAAATCATAAAGATATTGGAACTCTCTATCTATTATTTGGAGCTTGAGCAGGCATAGTAGGTACTTCACTC---AGCTTACTAATTCGAGCTGAACTAGGACAACCAGGAGCTCTAATGGGTGAT---GACCAAATTTACAACGTTGTTGTTACAGCCCATGCATTCGTCATAATCTTTTTTATAGTTATGCCTATTATACTTGGAGGTTTCGGAAACTGACTAGTACCACTTATA---ATTGGGGCCCCCGATATAGCTTTTCCCCGAATAAATAATATAAGCTTCTGACTTCTTCCCCCATCATTTTTACTTCTTCTCGCATCCTCTATAGTAGAAGCAGGAGTAGGAACAGGCTGAACTGTTTACCCCCCATTAGCTGGAAATATAGCACATGCAGGCTGCTCTGTTGACCTA---GCTATTTTTTCACTTCACCTCGCCGGTGTTTCATCCATTTTGGGAGCAATTAATTTCATTACCACTATCATTAATATGAAACCACCAGCTATATCTCAATACCAAACTCCCTTATTTGTCTGATCCATTTTAATTACAGCAGTTCTTTTATTATTAGCTTTACCTGTTCTAGCTGCC---GGTATTACTATATTATTAACAGACCGAAATATTAATACAACGTTTTTTGACCCTGCTGGAGGAGGTGACCCTATTTTATATCAACATTTATTCTGATTTTTTGGCCACCCTGAAGTTTACATTTTAAATCATCCTGGATTTGGCATTATTTCCCACATTGTAACTTATTATTCAGGTAAAAAA---GAACCCTTCGGTTATATAGGGATAGTTTGAGCAATAATATCAATTGGATTTTTAGGCTTTATCGTATGAGCCCACCATATATTTACAGTAGGATTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hemiechinus auritus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Stubbe, M., Samiya, R., Ariunbold, J., Buuveibaatar, V., Dorjderem, S., Monkhzul, Ts., Otgonbaatar, M., Tsogbadrakh, M., Zagorodniuk, I., Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G. & Palomo, L.J.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
This species has a large population size and a wide distribution. No decline in population size has been detected, and there are no known widespread major threats. Consequently this species is assessed as Least Concern. However, taxonomic research is required and may result into this taxon being split into several different species; in that case reassessment will be necessary.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Little is known about the occurrence of Hemiechinus auritus, but they appear to be plentiful in their ranges.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Least Concern.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Common.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a widespread and common species across most of the distribution area, although some marginal populations are fragmented and declining (e.g., in Ukraine).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
No major threats are known for most of the distribution area.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in a number of protected areas throughout its wide range. There are no specific conservation measures necessary for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hemiechinus auratus is considered beneficial because it eats many harmful insects, including termites and even scorpions. It does not damage agricultural crops since it lives largely in waste land on the edge of cultivation or in open desert.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Long-eared hedgehog

The Long-eared hedgehog (Hemiechinus auritus) is a species of hedgehog native to Central Asian countries and the Middle East. The long-eared hedgehog lives in burrows that it either makes or finds and is distinguished by its long ears. It is considered one of the smallest middle eastern hedgehogs.[3] This Hedgehog is insectivorous [4] but may also feed on small vertebrates and plants.[3] In captivity they may live as long as 7.6 years.[5]

Since the long-eared hedgehog is naturally parasite prone and can carry diseases as bad as plague, it is highly recommended that, if kept as pet, it should be purchased from a respected dealer. Wild hedgehogs have been found to carry Rhipicephalus sanguineus, the brown dog tick, which can transmit Boutonneuse fever.[6]

Contents

Description

Long-eared hedgehogs in Leningrad Zoo

The length of the head and body of the long-eared hedghog is approximately 120–270 mm, and the tail is 10–50 mm long.[7] The skull is about 38–48 mm long. Unlike other species the pterygoids of the skull do not inflate and they do not relay information to the tympanic membrane. The ears of this hedgehog are 30–45 mm longer than the closest spine.[3] They are used for heat radiation in the desert. Long-eared hedgehogs have great senses of hearing and smell that they use to hunt out food and detect predators.[7] The long-eared Hedgehog's spines are embedded in a unique muscle sheath that forms a bag like structure which acts as protection for the hedgehog. They can with draw into this pouch and erect their spines out to fend off predators if need be.[8] The dorsal spines are white on the tip with darker banding below. They do not have dark and light areas on their faces. Also they do not have a gap of spines on the back of their necks that is common to other species of hedgehogs.[3] The long-eared hedgehog has a light colored underside along with whitish hairs on the tips of their ears. The tops and heels of their feet are covered with hair but the soles are bare.[9]

The long-eared hedgehog is smaller than the West European hedgehog; it weighs between 250-400 grams,[3] and is much faster. It is less likely to curl up in a ball when approached by predators and will rather try and outrun or leap at predators with their relatively short needles.[7]

Diet

The long-eared hedgehog is an insectivore; 70% of its diet consists of insects, beetles and caterpillars, with some worms and a tiny amount of slugs and snails. The idea that these animals eat only slugs and snails is a myth; this type of food makes up only about 5% of their natural diet. The break-down of a wild hedgehogs diet is as follows: 30% beetles, 25% caterpillars, 11% earthworms, 10% bird eggs, 5% mammal meat, 5% slugs and snails, 3% millipedes, 3% earwigs, 2% bees, 1% bird meat and 5% that has been undefined by researchers. This diet breakdown is not specific to Hemiechinus auritus but a generalization about most hedgehog species.[10]

More specific to this species, Hemiechinus auritus is an insectivore that forages in the early evening looking for insects, myriapods, gastropods, batrachians (amphibians), small vertebrates and plants. It may even eat snakes or other vertebrates by curling up to protect its underside as it eats the struggling prey. They prefer to live near a water source.[3] However if this is not available they depend on their food source for their water intake [11] The long-eared Hedgehog is active throughout much of the year and hibernates for shorter periods of time. The longest reported hibernation is 40 days.[3] This hibernation may come in the summer or the winter. Also this Hedgehog will travel up to 9 km during the night in search of food.[7]

Predators

The long-eared hedgehog is hunted by the Eurasian Eagle Owl and makes up about 14% of the predatory birds diet.[12] It has been reported as prey for the Pharaoh eagle owl in the Azraq Nature Reserve in Jordan.[13]

Distribution and habitat

Hemiechinus auritus has a range that extends from the eastern Mediterranean region, through the arid and steppe areas of Asia to western Pakistan in the south; and from eastern Ukraine through Mongolia (Gobi desert), to China (Xinjiang).[3] This species is native to the following countries: Afghanistan; China; Cyprus; Egypt; Iran; Iraq; Israel; Kyrgyzstan; Lebanon; Libya; Mongolia; Pakistan; Russia; Syria; Tajikistan; Turkey; Turkmenistan; Ukraine and Uzbekistan.

The long-eared Hedgehog prefers to stay in intermediate climates, avoiding the hot desert and the northern colder mountain areas. Also they prefer areas with moderate rainfall of 100-400mm.[3]

The long-eared hedgehog inhabits a few different types of dry steppes, semi-deserts and deserts. It prefers dry river valleys, gullies, forest shelter belts, abandoned irrigation ditches and shrubby areas, and often settles in oases and around human settlements (sometimes in cultivated habitats).[2] They live in burrows that they dig under bushed with a length of 45 cm long with only one opening. They may also inhabit abandoned burrows of other small mammals. They are nocturnal solitary hedgehogs. During the day they are found resting under rocks, hollows or rock piles.[7]

Reproduction

The long-eared hedgehog only breeds once a year in the summer months of July through September. The presence of spines does not inhibit this species ability to reproduce.[7] Long-eared Hedgehogs gestation period is 35–42 days. The female has 8-10 nipples and often has 2-3 babies.[3] After just one week the babies start eating solid food. They are born with very few spines and within five hours after birth the spines have doubled in size. After two weeks the babies are fully covered with their new spines.[7]

Impact

Long eared Hedgehogs can be agriculturally beneficial since they eat harmful organisms like termites and scorpions. They are not found to damage crops since they live in areas that are mostly waste land and desert.[7]

References

  1. ^ a b Hutterer, Rainer (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M.. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 215. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ a b Stubbe, M., Samiya, R., Ariunbold, J., Buuveibaatar, V., Dorjderem, S., Monkhzul, Ts., Otgonbaatar, M., Tsogbadrakh, M., Zagorodniuk, I., Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G. & Muñoz, L.J.P. (2008). Hemiechinus auritus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 2009-04-01. Database entry includes a brief justification of why this species is of least concern
  3. ^ a b c d e f g h i j Qumsiyeh, M. B.. (1996) Mammals of the Holy Land. Texas Tech University Press, Lubbock Texas. pg 64-66.
  4. ^ Poddar-Sarkar, M., Raha, P., Bhar, R., Chakraborty, A., & Brahmachary, R. (2011). Ultrastructure and lipid chemistry of specialized epidermal structure of Indian porcupines and hedgehog. Acta Zoologica, 92(2), 134-140. doi:10.1111/j.1463-6395.2010.00452.x
  5. ^ de Magalhaes, J. P., and Costa, J. (2009) "A database of vertebrate longevity records and their relation to other life-history traits." Journal of Evolutionary Biology 22(8):1770-1774
  6. ^ Cunningham, P. L., & Thompson, K. (2009). "Tick-host relationships as determined from wildlife in the United Arab Emirates (Acarina, Fam. Ixodidae) – a preliminary study". Tribulus magazine. http://www.enhg.org/​trib/​trib05.htm. 
  7. ^ a b c d e f g h Ballenger, L. 1999. "Hemiechinus auritus" (On-line), Animal Diversity Web. Accessed November 28, 2011 http://animaldiversity.ummz.umich.edu/site/accounts/information/Hemiechinus_auritus.html
  8. ^ Catania, K. (2005). Evolution of sensory specialization in insectivores. Anatomical record part A, 287A (1), 1038-1050 DOI:10.1002/ar.a.20265
  9. ^ Colak, E., Yigit, N., Sozen, M. & Ozkurt, S. (1998). A study on the long-eared hedgehog, Hemiechinus auritus (Gmelin, 1770) (Mammalia: Insectivora) in Turkey. Tr. J. of Zoology . 22, 131-136.
  10. ^ Feeding Hedgehogs and the Hedgehog Diet. thehedgehog.co.uk
  11. ^ Sharma, A., & Mathur, R. S. (1974). Histomorphological Changes in the Reproductive Tract of Female Hemiechinus auritus collaris, Gray in Relation to the Estrous Cycle. Acta Zoologica, 55235-243. Retrieved from EBSCOhost.
  12. ^ Navarro, J. et al. (2003). "Diet of Three Sympatric Owls in Steppe Habitats of Eastern Kazakhstan". Journal of Raptor Research 37 (3): 256–258. http://elibrary.unm.edu/sora/jrr/v037n03/p00256-p00258.pdf. 
  13. ^ Shehab, A. H., & Ciach, M. (2008). Diet Composition of the Pharaoh Eagle Owl, Bubo ascalaphus, in Azraq Nature Reserve, Jordan. Turkish Journal of Zoology, 32(1), 65-69. Retrieved from EBSCOhost.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!