Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Description

The hedgehog is one of our most instantly recognisable native mammals, as it is the only British mammal to have spines (2). They are also characterised by their fairly short tails, long legs and small ears (6). Young hedgehogs are born with a coat of soft, white spines, which are underneath the skin to protect the mother during birth, but emerge after a few hours (7). A second coat of dark spines emerges after about 36 hours, and later on a third set develops. By 11 days of age the young hedgehogs can curl into a ball, and after 14 days the eyes open (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

You can't mistake hedgehogs with other animals: they have needles on their back. Adult hedgehogs have around 8000 needles. At night, they hunt small animals, from insects to small predators. They also eat eggs, reptiles, fruit and mushrooms. They often make a lot of noise when they eat and you can hear them smacking from far away. During the summer, hedgehogs sleep in protected places during the day. They hibernate in the winter, sleeping day and night. With the exception of Texel and Langeoog, it took a long time before hedgehogs were found on the Wadden Islands. However, slowly but surely they have spread to all of the islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Hedgehogs are nocturnal animals, and can travel up to 1-2 km per night whilst foraging for food. They have a broad diet, including worms, slugs, caterpillars and many other invertebrates (2), as well as frogs, berries (6) and the eggs and chicks of ground-nesting birds (2). Due to a variable resistance to adder venom, hedgehogs can even attack and eat adders (7). Hedgehogs are good swimmers, can run fairly quickly, and are well known for their habit of rolling into a tight ball when threatened (8). They hibernate in winter in a nest made of leaves, typically under sheds or log piles. They emerge from hibernation around Easter time, and breeding occurs between April and September. Females give birth to 4-5 young per litter, and are left to raise the young alone (2). Like other hedgehogs, this species has the peculiar habit of 'self-anointing', in which the hedgehog produces a large amount of foamy saliva and licks the saliva over its spines. The purpose of this behaviour is a mystery (9), but it can be triggered by strong smells, new foods, and the presence of other hedgehogs (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Erinaceus europaeus (European hedgehog) is commonly found across Europe and into central Asia. Native to this region, it can be found from the Archipelago of the Azores and as far east as Khazakstan. It is commonly seen in northern Europe, as far as Scandinavia. While it is generally not found south of the Mediterranean Sea, it has been seen in Lebanon. Erinaceus europaeus is also found in New Zealand, where they were introduced in the late 1800s.

Biogeographic Regions: palearctic (Native ); australian (Introduced )

  • National Museum of Natural History, Smithsonian Institution. 2011. "Division of Mammals Collections: Search "Erinaceus europaeus"" (On-line). Accessed April 03, 2011 at http://collections.nmnh.si.edu/search/mammals/.
  • Bogdanov, A., A. Bannikova, Y. Pirusskii, N. Formozov. 2009. The first genetic evidence of hybridization between West European and Northern white-breasted hedgehogs (Erinaceus europaeus and E. roumanicus) in Moscow region. Biology Bulletin, 36/6: 647-651. Accessed March 18, 2011 at http://www.springerlink.com/content/p110772hh53p71h7/.
  • Brockie, R. 1959. Observations of the food of the hedgehog (Erinaceus europaeus L.) in New Zealand. New Zealand Journal of Science, 2: 121-136.
  • Mathias, M., M. Ramalhinho, M. Santos-Reis, F. Petrucci-Fonseca, R. Libios, R. Fons, G. Ferraz de Carvalho, M. Oom, M. Collares-Pereira. 1998. Mammals from the Azores islands (Portugal): An updated overview.. Mammalia, 62: 397-407.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Erinaceus europaeus is endemic to Europe (including European Russia), with a global distribution extending from the British Isles and the Iberian peninsula, westwards through much of western to central Europe; and from southern Fennoscandia, and the northern Baltic to north-west Russia. It was introduced recently to the Azores (Portugal); the species was recorded there in the 1990s (R. Hutterer pers. comm. 2007). In the Mediterranean, it occurs in Portugal, France (including Corsica), Spain and Italy (including Sardinia and Sicily but not present on Malta).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species is found in western Europe (9). In Britain it is widely distributed, and has been introduced to several islands (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The European hedgehog is a small, round animal with short legs that raise it about 1 inch above the ground. It is plantigrade and has 5 well developed pads and claws on each foot. The first and fifth toes are smaller and weaker than the second, third, and fourth toes. Its coat is white and brown and consists of 3/4 to 1 inch spines, arranged in a radiating pattern, that cover all but its cheeks, throat, stomach, and limbs. Areas not covered in spines are covered in a coarse hair that is yellow-brown in color, though white hedgehogs have been seen. It has an elongated, conical head and snout, a small braincase, a short neck and tail, and well developed eyes and ears. The length of its body ranges from 135 to 265 mm, and males are usually slightly larger than females. The tail is about 20 mm long.

The spines covering the European hedgehog's body have white tips and bases and are covered with alternating brown and black bands. They are hollow and have longitudinal grooves, which decrease their weight. Spines are made of keratin and are attached to the skin in a similar way to hair. Each spine grows from a follicle in the skin that is attached to a small muscle (arrector pili) that is used for piloerection. When a hedgehog rolls into a ball, all of the spines can be erected simultaneously, which is made possible by the panniculus carnosis, a sheet of muscle that covers its back. An adult hedgehog usually has around 5,000 spines covering its body.

Erinaceus europaeus has lacteal and permanent teeth. The permanent dentition features widely space upper incisors such that the lower incisors fit between them. The dental formula for E. europaeus is 3/2, 1/1, 2/3, 3/3.

Range mass: 800 to 1200 g.

Range length: 135 to 165 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 2.434 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The European hedgehog is found in temperate fields, especially field edges and hedgerows. They prefer drier areas that are not thickly wooded and are occasionally found in scrub and sand dunes. European hedgehogs are commensal and are often found in home gardens, cemeteries, parks, agroecosystems, and other areas that provide appropriate places for hibernation. It commonly occupies elevations from sea level to 2400 m throughout its geographic range.

Range elevation: 0 to 2400 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
E. europaeus thrives in a variety of man-made habitats including orchards, vineyards, farmland, parks and gardens, including those in urban areas. It also occurs in deciduous woodland, woodland edge and grasslands, although it is less common in these areas (Lapini 1999). Also occurs in maquis (R. Hutterer pers. comm. 2007).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The hedgehog occupies a range of lowland habitats with enough cover to allow nesting (9). It is common in parks, farmland and gardens (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

European hedgehogs are omnivorous, but predominantly feed on insects. They favor beetles, ants, bees, wasps, earwigs, butterflies and moths. Hedgehogs may also eat cockroaches, crickets, grasshoppers, snails, eggs, lizards, snakes, frogs, small rodents, and carrion.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Hedgehogs are omnivorous, feeding on a wide variety of animal (especially insect) and plant material. They may help control insect pest populations in some areas. Hedgehogs are hosts to a variety of parasites including nematodes (Crenosoma striatum, Eucoleus aerophilus, Capillaria erinacei, Capillaria ovoreticulata and Capillaria spp.), trematodes (Brachylaemus erinacei), acanthocephalans (Oliganthorhynchus erinacei), ticks (Ixodes hexagonus), and fleas (Archeopsylla erinacei).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators of the Erinaceus europaeus include dogs, foxes, snakes, large owls, and badgers. To protect themselves, hedgehogs have the ability to curl into a defensive ball that exposes only erected spines. In order to form into a ball, they constriction the panniculus carnosus muscle. When this occurs, the muscles associated with each spine contract, leaving all of the hedgehog’s spines erect. Some predators, such as badgers and foxes, may be able to gain access to the hedgehog by wedging their noses into the crease where the top and bottom of the spiny coat meet. Predators have also been known to drop a balled hedgehog from a height so as to shock or injure the hedgehog long enough for them to take advantage of its exposed underbelly.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / parasite / ectoparasite / blood sucker
adult of Archaeopsylla erinacei erinacei sucks the blood of ear of Erinaceus europaeus

Animal / pathogen
Foot and Mouth virus (FMD) infects Erinaceus europaeus
Other: minor host/prey

Animal / parasite / ectoparasite / blood sucker
larva of Ixodes hexagonus sucks the blood of face of Erinaceus europaeus
Other: major host/prey

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Erinaceus europaeus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Erinaceus europaeus (hedgehog) preys on:
Isoptera
Coleoptera
Hymenoptera
Auchenorrhyncha
Pteroclididae
Columbidae
Alaudidae
Araneae
Cicindelidae
Camponotus pennsylvanicus
Rodentia

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Erinaceus europaeus (hedgehog) is prey of:
Felis silvestris libyca
Canis lupus familiaris

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

European hedgehogs are not particularly noisy, and make mostly grunting, snorting, and hoarse squeaking sounds. Adults are vocal during mating, while feeding, and occasionally when captured. Young may squeak and whistle while in the nest. Due to its nocturnal behavior, European hedgehogs rely heavily on their senses of smell and hearing. In addition to having a well developed sense of smell, they, like many mammals, have a Jacobson's organ in their palate. The organ may have a role in social behavior as both male and female hedgehogs have a variety of scent glands. While the mechanisms of hearing in E. europaeus have not been well studied, research on a related species, the Long-eared hedgehog, has found it capable of processing high-frequency sounds up to 45kHz.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In the wild, European hedgehogs can live up to six years. In captivity, they can live as many as ten years.

Range lifespan

Status: wild:
8 (high) years.

Range lifespan

Status: captivity:
11.7 (high) years.

Typical lifespan

Status: wild:
6 (high) years.

Typical lifespan

Status: captivity:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.7 years (captivity) Observations: On average this animal reaches sexual maturity 3 months earlier in captivity. In the wild they appear to live up to 7-8 years. One captive specimen lived for 11.7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

European hedgehogs are solitary and non-territorial. They begin the mating process when a male encounters a female, at which time the male encircles the female while she lowers her head and makes a variety snorts, grunts, and hisses. If the male is successful in courting the female, he attempts to mount her several times. After numerous copulations, the male leaves the female, and does not provide any parental care to his offspring. He continues to roam alone and attempts to mate with other females until he begins preparing for hibernation. Males and females have multiple mates each season.

Mating System: polygynandrous (promiscuous)

Erinaceus europaeus begins mating in late spring (April or May) when the the animal emerges from hibernation. Males, which emerge 3 to 4 weeks before females, expand their home range during mating season to increase chances of finding a mate. When a male finds a mate, he circles her while she lowers her nose and becomes audibly defensive. The male may circle for several hours, making several attempts to mount. If the female continually rejects the male, he eventually leaves to find a receptive female. If she accepts him, she flattens her spines and lowers herself to the ground, which gives the male better access. To copulate, a male climbs onto a female's back and uses his teeth to hold onto her shoulder. Gestation last for about 35 days. Females give birth to four to six offspring per litter, and often have two litters per year. The second litter, which is born later in the year, has a reduced chance of surviving winter. New borns are about 3 inches long and weigh 0.3 to 0.9 oz. At birth, E. europaeus does not appear to have spines, which are concealed beneath their fluid filled skin. 24 hours after birth, the fluid is absorbed and the spines are revealed, and, 2 to 3 days later, the young’s musculature is developed enough to allow it to hold the spines erect. These white adolescent spines are replaced by darker spines after about 1.5 days. Pigmented adult spines replace the first two coats after about 2 to 3 weeks, at which time young begin to open their eyes and learn how to roll into a ball. Young are weaned by 4 to 6 weeks old, after which they become independent of parental care, and are able to mate by about 1 year.

Breeding interval: Hedgehogs breed seasonally, and can have up to two litters per season

Breeding season: April to September

Range number of offspring: 1 to 9.

Range gestation period: 30 to 49 days.

Range weaning age: 4 to 6 weeks.

Range time to independence: 4 to 6 weeks.

Average age at sexual or reproductive maturity (female): 253 days.

Average age at sexual or reproductive maturity (male): 253 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 14.7 g.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
253 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
253 days.

Weaning usually occurs 6 weeks after birth, at which time young European hedhogs begin venturing out of the nest with their mother. They begin to forage and create an overwintering nest on their own. Most individuals are sexually mature by the first spring after their born.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Spines work as shock absorbers: West European hedgehog
 

The spines of hedgehogs function as shock-absorbers during falls thanks to their honeycomb-like core and longitudinal stiffening.

       
  "In the second category, comprising animals with masses between about 100 kilograms and 100 grams (4 ounces), falling may be injurious, but the fall must involve a distance greater than the height of the animal…Hedgehogs (about 500--1,000 grams in mass), are also just above the lower limit, but, according to Vincent and Owers (1986), cope with falls by using a special device--spines that can act as shock absorbers." (Vogel 2003:44)

"[T]he hedgehog spine is a shock-absorberThe foam-like structure down the center of spines and quills supports the thin outer walls against local buckling, allowing the structure to bend further without failingPorcupine quills perform more or less the same as hollow cylinders in buckling as struts with an axial load; in bending they are 40% or so better. But the spines of the hedgehog, with their square honeycomb core and longitudinal stiffening, are three times better than they would be without the core." (Vincent 2002:30-31)
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
  • Vincent, JFV. 2002. Survival of the cheapest. Materials Today. 5(12): 28-41.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Erinaceus europaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTCGTTGACTTTTTTCTACAAATCATAAGGATATTGGCACTCTTTATCTACTATTTGGAGCTTGAGCAGGTATAGTAGGCACCTCCCTTAGTCTATTGATTCGAATAGAGCTTGGCCAACCAGGAGCTTTATTAGGTGAT---GATCAGATTTACAATGTTGTCGTCACAGCCCATGCATTTGTTATAATTTTCTTTATAGTTATACCGATTATATTAGGAGGTTTTGGAAACTGGTTAGTACCTCTCATGATTGGAGCCCCTGACATAGCTTTCCCTCGAATAAATAATATAAGCTTTTGACTTCTACCTCCTTCATTTATTCTTCTTCTTACATCTTCTATAGTTGAAGCAGGAGTAGGTACCGGTTGAACTGTTTATCCCCCACTAGCAGGTAACATAGCCCATGCAGGCTCTTCCGTAGATCTAGCTATCTTCTCCCTGCACCTCGCAGGGGTCTCATCTATCTTGGGAGCAATTAATTTTATTACTACTATTATTAATATAAAACCACCTGCTGTATCCCAATATCAAACCCCCTTATTCGTCTGATCGATCTTAATTACAGCTATCCTTCTACTTCTAGCTCTACCAGTTCTAGCCGCAGGTATTACCATACTACTAACAGACCGTAATCTTAATACAACTTTTTTTGACCCCTCTGGAGGAGGTGATCCTATTCTATACCAACACTTATTTTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATTCTCCCAGGATTCGGCATTATTTCTCATATTGTAGCTTATTATTCTGGTAAAAAAGAACCTTTTGGCTATATAGGAATAGTATGAGCCATAATATCTATCGGGTTTTTAGGATTTATTGTATGAGCTCACCATATATTTACTGTAGGTTTAGATGTTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Erinaceus europaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Formerly a common sight in the UK, local populations of Erinaceus europaeus appear to be rapidly declining. Despite this, E. europaeus is listed as a species of least concern on the IUCN's Red List of Threatened Species. The reasons for its decline are unclear, however, E. europaeus has been included in the UK Biodiversity Action Plan.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G. & Palomo, L.J.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is common and abundant throughout its wide range. Consequently it is considered to be Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1), listed under Appendix III of the Bern Convention (3), and listed as a Priority Species under the UK Biodiversity Action Plan (4). Partially protected in the UK under Schedule 6 of the Wildlife and Countryside Act (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This generally is a relatively common and widespread species. It is rare in Sardinia (Italy), where it is hunted with dogs (R. Hutterer pers. comm. 2007). The is no evidence of any population decline in most parts of its range. Many of the island populations have been introduced there from the mainland (R. Hutterer pers. comm. 2007).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species across most of its range. In some areas, many hedgehogs are killed by collision with cars, but this is unlikely to cause serious population declines (Huijser 1999, Verkem et al. 2003). It is locally hunted and eaten in parts of its range, but this is a localised activity and is also not considered a serious threat to the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historically, hedgehogs have been persecuted as vermin; between 1566 and 1863, churchwardens made payments for hedgehogs killed in their parish (5). Today, a number of factors are thought to pose threats to hedgehogs, including agricultural changes such as pesticide use and the loss of hedgerows and grasslands, drowning in garden ponds, falling into cattle grids (9), road deaths, poisoning by garden chemicals, and deaths caused by mowing machines (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix III of the Bern Convention. It occurs in a number of protected areas throughout its wide range. It is also legally protected in many countries within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The conservation status of this species in the UK is unclear. It is thought, however, that hedgehogs are common on a national basis, although they may be in decline on a regional level, and may even be vulnerable in some areas (9). For ways to make your garden more hedgehog friendly, see the Mammal Society fact sheet (link below).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Hedgehogs are potential vectors for a number of parasites and pathogens including ticks, fleas, mites, ringworm, influenza, yellow fever, Salmonella enteritidis, leptospirosis, and foot and mouth disease.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hedgehogs are routinely kept as pets, but the European hedgehog is forbidden as a pet in Europe. Due to their broad diet, hedgehogs may help control insect pests. They have proven useful for the study of numerous diseases including foot and mouth disease, yellow fever, and influenza. Their hair and spines are useful in assessing for environmental pollutants including arsenic, silver, cadmium, lead, cobalt, and Persistant Organic Pollutants (POPs). Traditional remedies have incorporated the blood, entrails, or ashes of European hedgehogs, and some rituals involving hedgehogs have been used to cure baldness and predict the weather. Ancient Romans raised hedgehogs for their meat, and they used parts of the hedgehog, especially their spiny coat, for training work animals.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European hedgehog

The European hedgehog (Erinaceus europaeus: Linnaeus, 1758), or common hedgehog is a hedgehog species found in western Europe, from the Iberian Peninsula and Italy northwards into Scandinavia.[3] It is a generally common and widely distributed species that can survive across a wide range of habitat types. It is a well-known species, and a favourite in European gardens, both for its endearing appearance and its preference for eating a range of garden pests. While populations are currently stable across much of its range, it is thought to be declining severely in the UK.[4][5]

Description[edit]

Skeleton

E. europaeus has a generalised body structure with unspecialised limb girdles.[6] The animal appears brownish with most of its body covered by up to 6,000 brown and white spines.[7] Length of head and body is ~160 mm (6.3 in) at weaning, increasing to 260 mm (10 in) or more in large adults. This species has an extremely short tail as an almost vestigal feature, typically 20 to 30 mm (0.79 to 1.18 in).[8] Weight increases from around 120 g (4.2 oz) at weaning to > 1,100 g (2.4 lb) in adulthood. The maximum recorded weight is 2,000 g (4.4 lb), though few wild specimens exceed 1,600 g (3.5 lb) even in autumn.[9] Adult summer weight is typically somewhat less than in autumn, with an average of around 800 g (1.8 lb).[10] Males tend to be slightly larger than females, but sex differences in body weight are overshadowed by enormous seasonal variation.[8]

E. europaeus is unlike any other creature across most of its range. Where it co-exists with the Northern white-breasted hedgehog (Erinaceus roumanicus), the two species are difficult to distinguish in the field, the latter having a white spot on its chest.[11] According to the Guinness Book of World Records, E. europaeus is probably the largest species of hedgehog and is possibly the heaviest member of the Erinaceomorpha order, although the moonrat (Echinosorex gymnura), similar in average mass if not known to equal to the hedgehog's maximum weight, can attain a considerably greater length.[12]

Colour variation[edit]

Blonde hedgehog

Leucistic, or 'blonde' hedgehogs occasionally occur. Such specimens are believed to have a pair of rare recessive genes, giving rise to their black eyes and creamy-coloured spines; however, they are not strictly speaking albino. They are extremely rare, except on North Ronaldsay and the Channel Island of Alderney where around 25% of the population is thought to be blonde.[13] True albino forms of the hedgehog do also occur infrequently.[7]

Behaviour[edit]

This species is largely nocturnal. It has a hesitant gait, frequently stopping to smell the air. Unlike the smaller, warmer-climate species, the European hedgehog may hibernate in the winter. However, most wake at least once to move their nests. They are solitary in nature with mature males behaving aggressively towards each other. Occasionally a male and female may share a hibernating spot.[citation needed]

Diet[edit]

The European hedgehog is omnivorous, feeding mainly on invertebrates. Its diet includes slugs, earthworms, beetles, caterpillars and other insects. The preferred arthropods are the millipedes Glomeris marginata and Tachypodoiulus niger as well as the ground beetle Carabus nemoralis.[14] It also eats grass snakes, vipers, frogs, fish, small rodents, young birds and birds' eggs. Some fruits and mushrooms may supplement the diet.

Breeding[edit]

The breeding season commences after hibernation. Pregnancies peak between May and July, though they have been recorded as late as September. Gestation is 31 to 35 days. The female alone raises the litter which typically numbers between four and six, though can range from two to ten. Studies have indicated that litter size may increase in more northern climes. The young are born blind with a covering of small spines. By the time they are 36 hours old, the second, outer coat of spines begins to sprout. By 11 days they can roll into a ball. Weaning occurs at four to six weeks of age.[citation needed]

Longevity and mortality[edit]

European hedgehogs may live to ten years of age, although the average life expectancy is three years. Starvation is the most common cause of death, usually occurring during hibernation. If alarmed, the animal will roll into a ball to protect itself. Many potential predators are repelled by its spines, but predation does occur. Remains of hedgehogs have been found in the stomachs of European badgers (Meles meles), red foxes (Vulpes vulpes) and pine martens (Martes martes). A large portion of these may be from hedgehog carcasses, especially road-kill. However, hedgehogs tend to be absent from areas where badgers are numerous. Golden eagles (Aquila chrysaetos) and Eurasian eagle-owls (Bubo bubo) are the only regular avian predators of this species and may even prefer them as prey. The owl, after grabbing the hedgehog by its face, tends to skin the mammal's prickly back with its talons before consumption.[15] In Spain, reductions of European rabbit (Oryctolagus cuniculus) numbers due to Rabbit haemorrhagic disease has made the European hedgehog one of the top preferred prey species for eagle-owls.[16] On the Swedish island of Gotland the golden eagle may take larger numbers of hedgehogs than any other prey due to an otherwise low diversity of native land mammals, although the introduction of European rabbits has shifted the eagle's prey preferences there.[17]

Distribution[edit]

The European hedgehog is endemic to Europe (including European Russia), with a global distribution extending from the British Isles and the Iberian peninsula eastwards through much of western to central Europe, and from southern Fennoscandia and the northern Baltic to north-west Russia. Present also on Mediterranean islands (Corsica, Sardinia, Elba, Sicily), on most of the French Atlantic islands as well as on British Islands (autochthonous and introduced).[18] It is an invasive exotic species in New Zealand and has probably been introduced to Ireland and many of the smaller islands where it occurs.[19]

Habitat[edit]

The European hedgehog is found across a wide range of habitat types, encompassing both semi-natural vegetation types and those areas that have been heavily modified by man. The range includes woodland, grasslands such as meadows and pasture, arable land, orchards and vineyards as well as within the matrix of habitat types found in human settlements. It prefers lowlands and hills up to 400-600m, but is also locally present on mountains, exceptionally up to and altitude of 1500-200m (e.g. Alps and Pyrénées).[20] Outside cultivated land it prefers marginal zones of forests, particularly ecotonal grass and scrub vegetation.[21]

Hedgehogs are most abundant within the gardens, parks and amenity land close to or within human settlements.[22] They are generally scarce in areas of coniferous woodland, marshes and moorland, probably because of a lack of suitable sites and materials for the construction of winter nests (or hibernacula), which have specific requirements.[7]

Protection[edit]

Generally, the hedgehog is widely distributed and can be found in good numbers where people are tolerant of their residence in gardens. To date, the IUCN classifies the species as Least Concern and currently the population as Stable. In some areas, they are common victims of road kills and may be hunted by dogs, such as in Sardinia.[2] On 28 August 2007, the new Biodiversity Action Plan (BAP) [launched in 1997] included the European hedgehog on the list of species and habitats in the UK that need conservation and greater protection.[23][24]

In Denmark[25] and Poland,[26] hedgehogs are protected by law. It is illegal to capture or hurt them, but it is accepted to house underweight hedgehogs found out during winter.

A low coverage assembly of the genome of Erinaceus europaeus was released by the Broad Institute in June 2006 as part of the Mammalian Genome Project.[27]

Status in the UK[edit]

Population size[edit]

An estimate of 36.5 million by Burton[28] was based on extrapolating up from a density of 2.5 animals/ha (one per acre), but this was based on limited data and is probably an overestimate. A more recent estimate of 1,550,000 in Great Britain[29] (England 1,100,000, Scotland 310,000, Wales 140,000) is more reliable, but still has a high degree of uncertainty as it is based on very limited information about hedgehog density estimates for different habitat types.[3] Given this figure, and more firmly established rates of decline,[5] it is now thought likely that there are fewer than a million hedgehogs in Great Britain.[30]

Population status[edit]

In 2007 the hedgehog was classified a Biodiversity Action Plan ‘priority’ species in the UK, largely in response to negative trends identified in national surveys such as Mammals on Roads survey,[31] run by People's Trust for Endangered Species (PTES), that found an annual decline in counts of road casualties of around 7% from 2001 to 2004.[32][33] Historic data from the National Gamebag Census suggest a steady decline between 1960 and 1980.[34] Evidence from a questionnaire in 2005 and 2006 also supported an ongoing decline, with almost half of ~20,000 participants in PTES' Hogwatch survey[35] reporting the impression that there were fewer hedgehogs than there were five years earlier.[36]

A review of the available survey data for the population trend of the hedgehog in the UK was undertaken by the British Trust for Ornithology (BTO) in a report commissioned by PTES and the British Hedgehog Preservation Society (BHPS).[5] This concluded that, at a conservative estimate, 25% of the UK hedgehog population had been lost in a decade.[37] The report also highlighted the importance of long-term monitoring to provide datasets with sufficient power to allow the changes to the population to be identified. Currently, the most important monitoring programmes involved in collecting information about the status of the UK hedgehog population are PTES’ Mammals on Roads and Living with Mammals surveys, and the BTO Breeding Bird Survey and Garden BirdWatch survey.[38]

Pest status[edit]

This species has become a serious pest in areas where it has been introduced outside of its native range. One such location is the Western Isles of Scotland, where introduced hedgehogs eat the eggs of ground-nesting waders such as Common Snipe, Dunlin, Common Redshank and Northern Lapwing. It is also considered a pest in New Zealand where it preys upon various native fauna.[39]

See also[edit]

References[edit]

  1. ^ Hutterer, R. (2005). "Order Erinaceomorpha". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 214. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G. & Muñoz, L. J. P. (2008). "Erinaceus europaeus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 26 November 2011. 
  3. ^ a b Harris, S. & Yalden, D.W. (2008) Mammals of the British Isles: Handbook, 4th Edition, The Mammal Society, Southampton.
  4. ^ IUCN 'red list' Erinaceus europaeus
  5. ^ a b c Roos, S., Johnston, A. and Noble, D. (2012) UK hedgehog datasets and their potential for long-term monitoring. BTO Research Report No. 598.
  6. ^ Reeve, N. J. (1994) Hedgehogs. T & AD Poyser Ltd., London. p7
  7. ^ a b c Morris, P. A. (2006) The New Hedgehog Book. Whittet Books, London.
  8. ^ a b Harris, S. & Yalden, D.W. (2008). Mammals of the British Isles: Handbook, 4th edition. Mammal Society, Southampton. pp241-249.
  9. ^ Reeve, N. J. (1994) Hedgehogs. T & AD Poyser Ltd., London. p16
  10. ^ Dickman, C. R. (1988) Age-related dietary change in European hedgehog, Erinaceus europaeus. Journal of Zoology 215, 1-14.
  11. ^ IUCN 'red list' Erinaceus roumanicus
  12. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  13. ^ Morris, P. A. & Tutt, A. (1996) Leucistic hedgehogs on the island of Alderney. Journal of Zoology, 239, 387-389.
  14. ^ B. Lundrigan & J. Bidlingmeyer (2000). "Erinaceus europaeus: European hedgehog". Animal Diversity Web. University of Michigan. 
  15. ^ Owls of the World by Konig, Weick & Becking. Yale University Press (2009), ISBN 0300142277
  16. ^ Antonio Martínez, J., & Zuberogoitia, I. (2001). The response of the Eagle Owl (Bubo bubo) to an outbreak of the rabbit haemorrhagic disease. Journal für Ornithologie, 142(2), 204-211.
  17. ^ Tjernberg, M. (1981). Diet of the golden eagle Aquila chrysaetos during the breeding season in Sweden. Ecography, 4(1), 12-19.
  18. ^ Mitchell-Jones, A.J.; Amori, G.; Bogdanowicz, W.; Krystufek, B.; Reijnders, P.J.H.; Spitzenberger, F.; Stubbe, M.; Thissen, J.B.M.; Vohralik, V.; Zima, J. (1999) The atlas of European mammals, Poyser London.
  19. ^ Harris, S. & Yalden, D.W. (2008). Mammals of the British Isles: Handbook, 4th edition. Mammal Society, Southampton. pp38-39
  20. ^ Mitchell-Jones, A.J.; Amori, G.; Bogdanowicz, W.; Krystufek, B.; Reijnders, P.J.H.; Spitzenberger, F.; Stubbe, M.; Thissen, J.B.M.; Vohralik, V.; Zima, J. (1999) The atlas of European mammals, Poyser London. pp38-39.
  21. ^ • Mitchell-Jones, A.J.; Amori, G.; Bogdanowicz, W.; Krystufek, B.; Reijnders, P.J.H.; Spitzenberger, F.; Stubbe, M.; Thissen, J.B.M.; Vohralik, V.; Zima, J. (1999) The atlas of European mammals, Poyser London. pp38-39.
  22. ^ Young R. P., Davison J., Trewby I. D., Wilson G. J., Delahay R. J. and Doncaster C. P. (2006) Abundance of hedgehogs (Erinaceus europaeus) in relation to the density and distribution of badgers (Meles meles). Journal of Zoology 269: 349-356.
  23. ^ "Hedgehogs join 'protection' list". BBC News. 27 August 2007. Retrieved 20 October 2014. 
  24. ^ UK List of Priority Species. Biodiversity Action Plan. ukbap.org.uk
  25. ^ Pindsvin. The Forest and Nature Department of DenMark
  26. ^ Dz.U. 2004 nr 220 poz. 2237. Internetowy System Aktów Prawnych. Isap.sejm.gov.pl (in Polish). Retrieved on 2012-12-29.
  27. ^ "Hedgehog". Ensembl Genome Browser. Retrieved 11 June 2007. 
  28. ^ Burton, M. (1969) The Hedgehog: A Survival Book on Hedgehogs. London. Andre Deutsch.
  29. ^ Harris, S., Morris, P., Wray, S. and Yalden, D. (1995) A review of British mammals: population estimates and conservation status of British mammals other than cetaceans. JNCC, Peterborough.
  30. ^ Vaughan, Adam (29 January 2013) "Hedgehog population in dramatic decline" Guardian Online Retrieved 4 September 2013.
  31. ^ Mammals on Roads survey, PTES: more information.
  32. ^ Bright, P., George, L. and Balmforth, Z. (2005) Mammals on Roads: development and testing the use of road counts to monitor abundance (draft v. 9). A report to PTES/JNCC.
  33. ^ JNCC 'priority' species pages: Erinaceus europaeus.
  34. ^ Tapper, S. (1992) An Ecological Review from Shooting and Gamekeeping Records. Game Heritage. Game Conservancy Ltd.
  35. ^ HogwatchSurvey Report, PTES and BHPS.
  36. ^ Hof, A. R. (2009) A study of the current status of the hedgehog (Erinaceus europaeus) and its decline in Great Britain since 1960. PhD. Royal Holloway, University of London. Egham, Surrey, TW20 0EX, UK.
  37. ^ Wembridge, David. "The state of Britain’s hedgehogs 2011". People's Trust for Endangered Species. Retrieved 20 October 2014. 
  38. ^ Battersby, J. (2005) UK Mammals: Species Status and Population Trends. A report by the Tracking Mammals Partnership No. 1, JNCC/Tracking Mammals Partnership, Peterborough.
  39. ^ King, Carolyn (1985). Immigrant Killers: Introduced Predators and the Conservation of Birds in New Zealand. Auckland: Oxford University Press. ISBN 978-0-19-558115-7. 

Further reading[edit]

  • Mammals of Europe by David W. Macdonald & Priscilla Barrett. Princeton University Press (1993), ISBN 0-691-09160-9
  • The New Hedgehog Book by Pat Morris (2006), Whittet Books, London. ISBN 978-1873580714
  • Hedgehogs by Nigel Reeve (1994), Poyser Natural History, ISBN 0-85661-081-X
  • A Prickly Affair: The charm of the hedgehog by Hugh Warwick (2010). Penguin. ISBN 978-0141034294
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!