Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Description

The hedgehog is one of our most instantly recognisable native mammals, as it is the only British mammal to have spines (2). They are also characterised by their fairly short tails, long legs and small ears (6). Young hedgehogs are born with a coat of soft, white spines, which are underneath the skin to protect the mother during birth, but emerge after a few hours (7). A second coat of dark spines emerges after about 36 hours, and later on a third set develops. By 11 days of age the young hedgehogs can curl into a ball, and after 14 days the eyes open (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

You can't mistake hedgehogs with other animals: they have needles on their back. Adult hedgehogs have around 8000 needles. At night, they hunt small animals, from insects to small predators. They also eat eggs, reptiles, fruit and mushrooms. They often make a lot of noise when they eat and you can hear them smacking from far away. During the summer, hedgehogs sleep in protected places during the day. They hibernate in the winter, sleeping day and night. With the exception of Texel and Langeoog, it took a long time before hedgehogs were found on the Wadden Islands. However, slowly but surely they have spread to all of the islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Hedgehogs are nocturnal animals, and can travel up to 1-2 km per night whilst foraging for food. They have a broad diet, including worms, slugs, caterpillars and many other invertebrates (2), as well as frogs, berries (6) and the eggs and chicks of ground-nesting birds (2). Due to a variable resistance to adder venom, hedgehogs can even attack and eat adders (7). Hedgehogs are good swimmers, can run fairly quickly, and are well known for their habit of rolling into a tight ball when threatened (8). They hibernate in winter in a nest made of leaves, typically under sheds or log piles. They emerge from hibernation around Easter time, and breeding occurs between April and September. Females give birth to 4-5 young per litter, and are left to raise the young alone (2). Like other hedgehogs, this species has the peculiar habit of 'self-anointing', in which the hedgehog produces a large amount of foamy saliva and licks the saliva over its spines. The purpose of this behaviour is a mystery (9), but it can be triggered by strong smells, new foods, and the presence of other hedgehogs (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Erinaceus europaeus is endemic to Europe (including European Russia), with a global distribution extending from the British Isles and the Iberian peninsula, westwards through much of western to central Europe; and from southern Fennoscandia, and the northern Baltic to north-west Russia. It was introduced recently to the Azores (Portugal); the species was recorded there in the 1990s (R. Hutterer pers. comm. 2007). In the Mediterranean, it occurs in Portugal, France (including Corsica), Spain and Italy (including Sardinia and Sicily but not present on Malta).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Erinaceus europaeus (European hedgehog) is commonly found across Europe and into central Asia. Native to this region, it can be found from the Archipelago of the Azores and as far east as Khazakstan. It is commonly seen in northern Europe, as far as Scandinavia. While it is generally not found south of the Mediterranean Sea, it has been seen in Lebanon. Erinaceus europaeus is also found in New Zealand, where they were introduced in the late 1800s.

Biogeographic Regions: palearctic (Native ); australian (Introduced )

  • National Museum of Natural History, Smithsonian Institution. 2011. "Division of Mammals Collections: Search "Erinaceus europaeus"" (On-line). Accessed April 03, 2011 at http://collections.nmnh.si.edu/search/mammals/.
  • Bogdanov, A., A. Bannikova, Y. Pirusskii, N. Formozov. 2009. The first genetic evidence of hybridization between West European and Northern white-breasted hedgehogs (Erinaceus europaeus and E. roumanicus) in Moscow region. Biology Bulletin, 36/6: 647-651. Accessed March 18, 2011 at http://www.springerlink.com/content/p110772hh53p71h7/.
  • Brockie, R. 1959. Observations of the food of the hedgehog (Erinaceus europaeus L.) in New Zealand. New Zealand Journal of Science, 2: 121-136.
  • Mathias, M., M. Ramalhinho, M. Santos-Reis, F. Petrucci-Fonseca, R. Libios, R. Fons, G. Ferraz de Carvalho, M. Oom, M. Collares-Pereira. 1998. Mammals from the Azores islands (Portugal): An updated overview.. Mammalia, 62: 397-407.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This species is found in western Europe (9). In Britain it is widely distributed, and has been introduced to several islands (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The European hedgehog is a small, round animal with short legs that raise it about 1 inch above the ground. It is plantigrade and has 5 well developed pads and claws on each foot. The first and fifth toes are smaller and weaker than the second, third, and fourth toes. Its coat is white and brown and consists of 3/4 to 1 inch spines, arranged in a radiating pattern, that cover all but its cheeks, throat, stomach, and limbs. Areas not covered in spines are covered in a coarse hair that is yellow-brown in color, though white hedgehogs have been seen. It has an elongated, conical head and snout, a small braincase, a short neck and tail, and well developed eyes and ears. The length of its body ranges from 135 to 265 mm, and males are usually slightly larger than females. The tail is about 20 mm long.

The spines covering the European hedgehog's body have white tips and bases and are covered with alternating brown and black bands. They are hollow and have longitudinal grooves, which decrease their weight. Spines are made of keratin and are attached to the skin in a similar way to hair. Each spine grows from a follicle in the skin that is attached to a small muscle (arrector pili) that is used for piloerection. When a hedgehog rolls into a ball, all of the spines can be erected simultaneously, which is made possible by the panniculus carnosis, a sheet of muscle that covers its back. An adult hedgehog usually has around 5,000 spines covering its body.

Erinaceus europaeus has lacteal and permanent teeth. The permanent dentition features widely space upper incisors such that the lower incisors fit between them. The dental formula for E. europaeus is 3/2, 1/1, 2/3, 3/3.

Range mass: 800 to 1200 g.

Range length: 135 to 165 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 2.434 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
E. europaeus thrives in a variety of man-made habitats including orchards, vineyards, farmland, parks and gardens, including those in urban areas. It also occurs in deciduous woodland, woodland edge and grasslands, although it is less common in these areas (Lapini 1999). Also occurs in maquis (R. Hutterer pers. comm. 2007).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The European hedgehog is found in temperate fields, especially field edges and hedgerows. They prefer drier areas that are not thickly wooded and are occasionally found in scrub and sand dunes. European hedgehogs are commensal and are often found in home gardens, cemeteries, parks, agroecosystems, and other areas that provide appropriate places for hibernation. It commonly occupies elevations from sea level to 2400 m throughout its geographic range.

Range elevation: 0 to 2400 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The hedgehog occupies a range of lowland habitats with enough cover to allow nesting (9). It is common in parks, farmland and gardens (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

European hedgehogs are omnivorous, but predominantly feed on insects. They favor beetles, ants, bees, wasps, earwigs, butterflies and moths. Hedgehogs may also eat cockroaches, crickets, grasshoppers, snails, eggs, lizards, snakes, frogs, small rodents, and carrion.

Animal Foods: birds; mammals; amphibians; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasite / ectoparasite / blood sucker
adult of Archaeopsylla erinacei erinacei sucks the blood of ear of Erinaceus europaeus

Animal / pathogen
Foot and Mouth virus (FMD) infects Erinaceus europaeus
Other: minor host/prey

Animal / parasite / ectoparasite / blood sucker
larva of Ixodes hexagonus sucks the blood of face of Erinaceus europaeus
Other: major host/prey

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Erinaceus europaeus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Hedgehogs are omnivorous, feeding on a wide variety of animal (especially insect) and plant material. They may help control insect pest populations in some areas. Hedgehogs are hosts to a variety of parasites including nematodes (Crenosoma striatum, Eucoleus aerophilus, Capillaria erinacei, Capillaria ovoreticulata and Capillaria spp.), trematodes (Brachylaemus erinacei), acanthocephalans (Oliganthorhynchus erinacei), ticks (Ixodes hexagonus), and fleas (Archeopsylla erinacei).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of the Erinaceus europaeus include dogs, foxes, snakes, large owls, and badgers. To protect themselves, hedgehogs have the ability to curl into a defensive ball that exposes only erected spines. In order to form into a ball, they constriction the panniculus carnosus muscle. When this occurs, the muscles associated with each spine contract, leaving all of the hedgehog’s spines erect. Some predators, such as badgers and foxes, may be able to gain access to the hedgehog by wedging their noses into the crease where the top and bottom of the spiny coat meet. Predators have also been known to drop a balled hedgehog from a height so as to shock or injure the hedgehog long enough for them to take advantage of its exposed underbelly.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Erinaceus europaeus (hedgehog) preys on:
Isoptera
Coleoptera
Hymenoptera
Auchenorrhyncha
Pteroclididae
Columbidae
Alaudidae
Araneae
Cicindelidae
Camponotus pennsylvanicus
Rodentia

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Erinaceus europaeus (hedgehog) is prey of:
Felis silvestris libyca
Canis lupus familiaris

Based on studies in:
India, Rajasthan Desert (Desert or dune)

This list may not be complete but is based on published studies.
  • I. K. Sharma, A study of ecosystems of the Indian desert, Trans. Indian Soc. Desert Technol. and Univ. Center Desert Stud. 5(2):51-55, from p. 52 and A study of agro-ecosystems in the Indian desert, ibid. 5:77-82, from p. 79 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

European hedgehogs are not particularly noisy, and make mostly grunting, snorting, and hoarse squeaking sounds. Adults are vocal during mating, while feeding, and occasionally when captured. Young may squeak and whistle while in the nest. Due to its nocturnal behavior, European hedgehogs rely heavily on their senses of smell and hearing. In addition to having a well developed sense of smell, they, like many mammals, have a Jacobson's organ in their palate. The organ may have a role in social behavior as both male and female hedgehogs have a variety of scent glands. While the mechanisms of hearing in E. europaeus have not been well studied, research on a related species, the Long-eared hedgehog, has found it capable of processing high-frequency sounds up to 45kHz.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, European hedgehogs can live up to six years. In captivity, they can live as many as ten years.

Range lifespan

Status: wild:
8 (high) years.

Range lifespan

Status: captivity:
11.7 (high) years.

Typical lifespan

Status: wild:
6 (high) years.

Typical lifespan

Status: captivity:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.7 years (captivity) Observations: On average this animal reaches sexual maturity 3 months earlier in captivity. In the wild they appear to live up to 7-8 years. One captive specimen lived for 11.7 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

European hedgehogs are solitary and non-territorial. They begin the mating process when a male encounters a female, at which time the male encircles the female while she lowers her head and makes a variety snorts, grunts, and hisses. If the male is successful in courting the female, he attempts to mount her several times. After numerous copulations, the male leaves the female, and does not provide any parental care to his offspring. He continues to roam alone and attempts to mate with other females until he begins preparing for hibernation. Males and females have multiple mates each season.

Mating System: polygynandrous (promiscuous)

Erinaceus europaeus begins mating in late spring (April or May) when the the animal emerges from hibernation. Males, which emerge 3 to 4 weeks before females, expand their home range during mating season to increase chances of finding a mate. When a male finds a mate, he circles her while she lowers her nose and becomes audibly defensive. The male may circle for several hours, making several attempts to mount. If the female continually rejects the male, he eventually leaves to find a receptive female. If she accepts him, she flattens her spines and lowers herself to the ground, which gives the male better access. To copulate, a male climbs onto a female's back and uses his teeth to hold onto her shoulder. Gestation last for about 35 days. Females give birth to four to six offspring per litter, and often have two litters per year. The second litter, which is born later in the year, has a reduced chance of surviving winter. New borns are about 3 inches long and weigh 0.3 to 0.9 oz. At birth, E. europaeus does not appear to have spines, which are concealed beneath their fluid filled skin. 24 hours after birth, the fluid is absorbed and the spines are revealed, and, 2 to 3 days later, the young’s musculature is developed enough to allow it to hold the spines erect. These white adolescent spines are replaced by darker spines after about 1.5 days. Pigmented adult spines replace the first two coats after about 2 to 3 weeks, at which time young begin to open their eyes and learn how to roll into a ball. Young are weaned by 4 to 6 weeks old, after which they become independent of parental care, and are able to mate by about 1 year.

Breeding interval: Hedgehogs breed seasonally, and can have up to two litters per season

Breeding season: April to September

Range number of offspring: 1 to 9.

Range gestation period: 30 to 49 days.

Average birth mass: 14.7 g.

Range weaning age: 4 to 6 weeks.

Range time to independence: 4 to 6 weeks.

Average age at sexual or reproductive maturity (female): 253 days.

Average age at sexual or reproductive maturity (male): 253 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 14.7 g.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (male)

Sex: male:
253 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
253 days.

Weaning usually occurs 6 weeks after birth, at which time young European hedhogs begin venturing out of the nest with their mother. They begin to forage and create an overwintering nest on their own. Most individuals are sexually mature by the first spring after their born.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Spines work as shock absorbers: West European hedgehog
 

The spines of hedgehogs function as shock-absorbers during falls thanks to their honeycomb-like core and longitudinal stiffening.

       
  "In the second category, comprising animals with masses between about 100 kilograms and 100 grams (4 ounces), falling may be injurious, but the fall must involve a distance greater than the height of the animal…Hedgehogs (about 500--1,000 grams in mass), are also just above the lower limit, but, according to Vincent and Owers (1986), cope with falls by using a special device--spines that can act as shock absorbers." (Vogel 2003:44)

"[T]he hedgehog spine is a shock-absorberThe foam-like structure down the center of spines and quills supports the thin outer walls against local buckling, allowing the structure to bend further without failingPorcupine quills perform more or less the same as hollow cylinders in buckling as struts with an axial load; in bending they are 40% or so better. But the spines of the hedgehog, with their square honeycomb core and longitudinal stiffening, are three times better than they would be without the core." (Vincent 2002:30-31)
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
  • Vincent, JFV. 2002. Survival of the cheapest. Materials Today. 5(12): 28-41.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Erinaceus europaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTCGTTGACTTTTTTCTACAAATCATAAGGATATTGGCACTCTTTATCTACTATTTGGAGCTTGAGCAGGTATAGTAGGCACCTCCCTTAGTCTATTGATTCGAATAGAGCTTGGCCAACCAGGAGCTTTATTAGGTGAT---GATCAGATTTACAATGTTGTCGTCACAGCCCATGCATTTGTTATAATTTTCTTTATAGTTATACCGATTATATTAGGAGGTTTTGGAAACTGGTTAGTACCTCTCATGATTGGAGCCCCTGACATAGCTTTCCCTCGAATAAATAATATAAGCTTTTGACTTCTACCTCCTTCATTTATTCTTCTTCTTACATCTTCTATAGTTGAAGCAGGAGTAGGTACCGGTTGAACTGTTTATCCCCCACTAGCAGGTAACATAGCCCATGCAGGCTCTTCCGTAGATCTAGCTATCTTCTCCCTGCACCTCGCAGGGGTCTCATCTATCTTGGGAGCAATTAATTTTATTACTACTATTATTAATATAAAACCACCTGCTGTATCCCAATATCAAACCCCCTTATTCGTCTGATCGATCTTAATTACAGCTATCCTTCTACTTCTAGCTCTACCAGTTCTAGCCGCAGGTATTACCATACTACTAACAGACCGTAATCTTAATACAACTTTTTTTGACCCCTCTGGAGGAGGTGATCCTATTCTATACCAACACTTATTTTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATTCTCCCAGGATTCGGCATTATTTCTCATATTGTAGCTTATTATTCTGGTAAAAAAGAACCTTTTGGCTATATAGGAATAGTATGAGCCATAATATCTATCGGGTTTTTAGGATTTATTGTATGAGCTCACCATATATTTACTGTAGGTTTAGATGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Erinaceus europaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G. & Palomo, L.J.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is common and abundant throughout its wide range. Consequently it is considered to be Least Concern.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Formerly a common sight in the UK, local populations of Erinaceus europaeus appear to be rapidly declining. Despite this, E. europaeus is listed as a species of least concern on the IUCN's Red List of Threatened Species. The reasons for its decline are unclear, however, E. europaeus has been included in the UK Biodiversity Action Plan.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1), listed under Appendix III of the Bern Convention (3), and listed as a Priority Species under the UK Biodiversity Action Plan (4). Partially protected in the UK under Schedule 6 of the Wildlife and Countryside Act (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This generally is a relatively common and widespread species. It is rare in Sardinia (Italy), where it is hunted with dogs (R. Hutterer pers. comm. 2007). The is no evidence of any population decline in most parts of its range. Many of the island populations have been introduced there from the mainland (R. Hutterer pers. comm. 2007).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species across most of its range. In some areas, many hedgehogs are killed by collision with cars, but this is unlikely to cause serious population declines (Huijser 1999, Verkem et al. 2003). It is locally hunted and eaten in parts of its range, but this is a localised activity and is also not considered a serious threat to the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historically, hedgehogs have been persecuted as vermin; between 1566 and 1863, churchwardens made payments for hedgehogs killed in their parish (5). Today, a number of factors are thought to pose threats to hedgehogs, including agricultural changes such as pesticide use and the loss of hedgerows and grasslands, drowning in garden ponds, falling into cattle grids (9), road deaths, poisoning by garden chemicals, and deaths caused by mowing machines (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Appendix III of the Bern Convention. It occurs in a number of protected areas throughout its wide range. It is also legally protected in many countries within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The conservation status of this species in the UK is unclear. It is thought, however, that hedgehogs are common on a national basis, although they may be in decline on a regional level, and may even be vulnerable in some areas (9). For ways to make your garden more hedgehog friendly, see the Mammal Society fact sheet (link below).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hedgehogs are potential vectors for a number of parasites and pathogens including ticks, fleas, mites, ringworm, influenza, yellow fever, Salmonella enteritidis, leptospirosis, and foot and mouth disease.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Hedgehogs are routinely kept as pets, but the European hedgehog is forbidden as a pet in Europe. Due to their broad diet, hedgehogs may help control insect pests. They have proven useful for the study of numerous diseases including foot and mouth disease, yellow fever, and influenza. Their hair and spines are useful in assessing for environmental pollutants including arsenic, silver, cadmium, lead, cobalt, and Persistant Organic Pollutants (POPs). Traditional remedies have incorporated the blood, entrails, or ashes of European hedgehogs, and some rituals involving hedgehogs have been used to cure baldness and predict the weather. Ancient Romans raised hedgehogs for their meat, and they used parts of the hedgehog, especially their spiny coat, for training work animals.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European hedgehog

The European hedgehog (Erinaceus europaeus), or common hedgehog, is a hedgehog species found in northern and western Europe. It is a common and well-known species, and is a favourite in European gardens, both for its unique, cute appearance and its insectivorous habits.

Description

Skeleton

This medium-sized mammal has a body of similar length to a large tree squirrel but is more heavily built and can weigh as much as a rabbit. It is considerably larger than the hedgehog species found in tropical and sub-tropical areas. Head-and-body length can range from 20 to 30 cm (7.9 to 12 in), with a vestigal tail adding only 1.5–3 cm (0.59–1.2 in). The adult weight typically ranges from 400 g (0.88 lb), after hibernation, to 1,200 g (2.6 lb), just prior to hibernation. The maximum recorded weight is 2,000 g (4.4 lb), though few specimens exceed 1,600 g (3.5 lb) even in autumn. According to the Guinness Book of World Records, this species is probably the largest species of hedgehog and is possibly the heaviest member of the Erinaceomorpha order, although the similarly-weighted moonrat can attain a considerably greater length.[3] Males tend to be slightly larger than females. The animal appears brownish with most of its body covered by up to 6,000 brown and white spines. In most of its range it is unlike any other creature. However, where it co-exists with the southern white-breasted hedgehog, the two species are difficult to distinguish in the field, the latter having a white spot on its chest.

Color variation

Blonde hedgehog

Blonde hedgehogs occasionally occur. Such specimens are believed to have a rare recessive gene, giving rise to their beady, button-black eyes and creamy-coloured spines; however, they are not strictly speaking albino. They are extremely rare except on the Channel Island of Alderney where a population of around a thousand is believed to exist. They allegedly carry no fleas, and are a localised island variant of Erinaceus europaeus.

Range

The European hedgehog is endemic to Europe (including European Russia), with a global distribution extending from the British Isles and the Iberian peninsula eastwards through much of western to central Europe, and from southern Fennoscandia and the northern Baltic to north-west Russia. It has been introduced to various European islands and as an exotic species to New Zealand.

Habitat

The European hedgehog is found in woodland, meadows and grassland, favouring border areas between these various habitats. Now, few hedgehogs reside in truly wild, remote regions. Instead they frequent the green edges of areas inhabited by humans. They are common in orchards, vineyards, farmland, parks and gardens, including those in urban areas. Their range extends to elevations of up to 2,000 m (6,600 ft) in pine zones, however they are not found above the tree line.

Behavior

This species is largely nocturnal. It has a hesitant gait, frequently stopping to smell the air. Unlike the smaller, warmer-climate species, the European hedgehog may hibernate in the winter. However, most wake at least once to move their nests. They are solitary in nature with mature males behaving aggressively towards each other. Occasionally a male and female may share a hibernating spot.

Diet

The European hedgehog is omnivorous, feeding mainly on invertebrates. Its diet includes slugs, earthworms, beetles, caterpillars and other insects. The preferred arthropods are the millipedes Glomeris marginata and Tachypodoiulus niger as well as the ground beetle Carabus nemoralis.[4] It also eats grass snakes, vipers, frogs, fish, small rodents, young birds and birds' eggs. Some fruits and mushrooms may supplement the diet.

Breeding

The breeding season commences after hibernation. Pregnancies peak between May and July, though they have been recorded as late as September. Gestation lasts from for 31 to 35 days. The female alone raises the litter which typically numbers between four and six, though can range from two to ten. Studies have indicated that litter size may increase in more northern climes. The young are born blind with a covering of small spines. By the time they are 36 hours old, the second, outer coat of spines begins to sprout. By 11 days they can roll into a ball. Weaning occurs at four to six weeks of age.

Longevity and mortality

European hedgehogs may live to ten years of age, although the average life expectancy is three years. Starvation is the most common cause of death, usually occurring during hibernation. If alarmed, the animal will roll into a ball to protect itself. Many potential predators are repelled by its spines, but predation does occur. Remains of hedgehogs have been found in the stomachs of European badgers, red foxes and pine martens. A large portion of these may be from hedgehog carcasses, especially road-kill. However, hedgehogs tend to be absent from areas where badgers are numerous. Golden eagles and Eurasian eagle-owls are habitually predators of this species and may even prefer them as prey, such as on the Swedish island of Gotland. The owl, after grabbing the hedgehog by its face, tends to skin the mammal's prickly back with its talons before consumption.[5]

Protection

Generally, the hedgehog is widely distributed and can be found in good numbers where people are tolerant of their residence in gardens. To date, the IUCN classifies the species as Least Concern and currently the population as Stable. In some areas, they are common victims of road kills and may be hunted by dogs, such as in Sardinia.[2] On 28 August 2007, the new Biodiversity Action Plan (BAP) [launched in 1997] included the European hedgehog on the list of species and habitats in the UK that need conservation and greater protection.[6][7]

In Denmark[8] and Poland,[9] hedgehogs are protected by law. It is illegal to capture or hurt them, but it is accepted to house underweight hedgehogs found out during winter.

A low coverage assembly of the genome of Erinaceus europaeus was released by the Broad Institute in June 2006 as part of the Mammalian Genome Project.[10]

Pest status

This species has become a serious pest in areas where it has been introduced outside of its native range. One such location is the Western Isles of Scotland, where introduced hedgehogs eat the eggs of ground-nesting waders such as Common Snipe, Dunlin, Common Redshank and Northern Lapwing. It is also considered a pest in New Zealand where it preys upon various native fauna.[11]

Mutations

There are known animals with albinos or blonde colors.[12] They are extremely rare except on the Channel Island of Alderney, where a blonde pair were released in the 1960s.[12]

See also

References

  1. ^ Hutterer, R. (2005). "Order Erinaceomorpha". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 214. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b Amori, G., Hutterer, R., Kryštufek, B., Yigit, N., Mitsain, G. & Muñoz, L. J. P. (2008). "Erinaceus europaeus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 26 November 2011. 
  3. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  4. ^ B. Lundrigan & J. Bidlingmeyer (2000). "Erinaceus europaeus: European hedgehog". Animal Diversity Web. University of Michigan. 
  5. ^ Owls of the World by Konig, Weick & Becking. Yale University Press (2009), ISBN 0300142277
  6. ^ Hedgehogs join 'protection' list. BBC News (2007-08-27). Retrieved on 2012-12-29.
  7. ^ UK List of Priority Species. Biodiversity Action Plan. ukbap.org.uk
  8. ^ Pindsvin. The Forest and Nature Department of DenMark
  9. ^ Dz.U. 2004 nr 220 poz. 2237. Internetowy System Aktów Prawnych. Isap.sejm.gov.pl (in Polish). Retrieved on 2012-12-29.
  10. ^ "Hedgehog". Ensembl Genome Browser. Retrieved 11 June 2007. 
  11. ^ King, Carolyn (1985). Immigrant Killers: Introduced Predators and the Conservation of Birds in New Zealand. Auckland: Oxford University Press. ISBN 978-0-19-558115-7. 
  12. ^ a b Pictured: The rare baby hedgehog who has blonde prickles | Mail Online. Dailymail.co.uk (2008-09-10). Retrieved on 2013-01-04.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!