Overview

Distribution

Range Description

This species is generally distributed in southern and south-western Madagascar. It has recently been recorded in south-eastern Madagascar (Goodman et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in the dry deciduous forest areas of western Madagascar and the xerophytic spiny forest and gallery regions of southwest Madagascar. It has also has been found in open grasslands tens of kilometres from forest, including in disturbed habitats of non-native vegetation (S.M. Goodman pers. comm).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19 years (captivity) Observations: In the wild, they become sexually mature after their first winter's hibernation, though females may conceive at six months of age in captivity. One captive specimen lived for 19 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Echinops telfairi

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0096-06|AJ400734|Echinops telfairi| AACCGTTGACTATTCTCTACTAATCATAAAGACATTGGAACCCTCTACTTATTATTCGGAGCTTGAGCTGGCACAGTAGGTACTGCTCTT---AGCCTCCTAATCCGTGCTGAACTCGGACAGCCAGGAGCCCTACTAGGTGAT---GACCAAATCTATAAGCTAATCGTAACTGCACACGCCTTCGTTATAATTTTCTTTATAGTTATACCCATTATGATTGGAGGATTTGGTAACTGACTGATCCCATTAATG---ATTGGTGCCCCTGACATAGCTTTCCCCCGAATAAATAACATAAGTTTCTGGCTCCTTCCCCCCTCTTTTCTTCTTCTGTTAGCTTCATCTATAGTTGAAGCAGGAGCAGGAACAGGCTGAACTGTTTATCCCCCCTTAGCTGGTAATCTCGCACATGCCGGAGCCTCAGTTGACTTA---ACAATTTTTTCTCTTCACTTAGCAGGTGTTTCGTCAATTTTAGGGGCTATTAATTTTATCACCACAGTGATTAATATAAAACCTCCAGCTATGACCCAATACCAAATACCCTTATTTGTCTGGTCAGTAGCTATTACTGCCGTACTTCTTCTACTTTCATTACCTGTACTTGCTGCA---GGAATCACTATACTTCTGACAGACCGTAATCTCAACACTACATTTTTTGACCCTGCAGGAGGAGGAGACCCTATTCTATATCAACACTTATTCTGATTCTTCGGCCACCCAGAGGTCTATATTCTGATTCTTCCAGGGTTTGGTATAATTTCTCATATCGTTACCTATTATTCAGGAAAAAAA---GAACCATTCGGGTATATAGGAATAGTATGGGCCATAATATCAATCGGTTTCTTAGGATTCATCGTCTGAGCTCATCATATATTTACTGTTGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Echinops telfairi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Olson, L. & Goodman, S. (IUCN SSC Afrotheria Specialist Group - Tenrec Section)

Reviewer/s
Rathbun, G. (Afrotheria Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, it occurs in a number of protected areas, has a tolerance of a degree of habitat modification, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is relatively common where sampled.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this widespread and adaptable species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is found in numerous protected areas, including Andohahela National Park and Berenty Private Reserve. No conservation measures are needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lesser Hedgehog Tenrec

The lesser hedgehog tenrec (Echinops telfairi) is a species of mammal in the Tenrecidae family.

It is the only species in the genus Echinops and is named in honour of Charles Telfair.[1]

Contents

Distribution and habitat

It is endemic to Madagascar. Its natural habitats are subtropical or tropical dry forests, dry savanna, subtropical or tropical dry shrubland, and subtropical or tropical dry lowland grassland.[2]

Description

The lesser hedgehog tenrec is a small, stout-bodied animal similar to the hedgehog, hence the name. Their tails are short, their limbs and muzzles are of moderate length, and their ears are prominent. The entire dorsum is covered with sharp spines. Color is usually yellow buff; individuals range from near white to almost black. Head and body length is 5 to 6.8 inches. Weight is about 7 ounces.

Behavior

This tenrec is both terrestrial and arboreal.

Shelter and hibernation

It spends its daytime hours resting under a log or in a hollow tree, although trees are widely scattered in its native habitat. In hot weather, it sleeps with its body extended but otherwise lies in a curled position. It hibernates in the winter time.

Diet

They feed upon, as to an insectivore, insects, but sometimes other small invertebrates as well as small vertebrates, and usually forage alone, except for a mother with her young.

Reproduction

Breeding is known to occur in October but may depend on warm weather first arousing the animals from winter torpor and on an available food supply. The gestation period lasts 62 to 65 days. The female then gives birth to averagely 7 babies (1-10). The young are weaned at 18 to 22 days of age.

References

  • Simon and Schuster's Guide to Mammals
  1. ^ a b Bronner, Gary N.; Jenkins, Paulina D. (16 November 2005). "Order Afrosoricida (pp. 71-81)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 76. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ a b Afrotheria Specialist Group (Tenrec Section), Olson, L. & Goodman, S. (2008). Echinops telfairi. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 29 December 2008.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!