Articles on this page are available in 1 other language: Spanish (8) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Notiochelidon cyanoleuca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTCGGCGCATGAGCGGGCATGGTAGGAACCGCCCTTAGCCTCCTCATTCGAGCAGAACTAGGACAACCAGGTGCCCTCCTTGGAGACGACCAAATCTACAACGTAGTCGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATCATAATTGGAGGGTTCGGAAACTGACTAGTCCCACTAATAATTGGCGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTTCCCCCATCATTCCTTCTCCTCCTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGGACCGGCTGAACCGTCTACCCCCCTCTAGCCGGAAACCTAGCCCACGCTGGGGCTTCCGTAGACTTAGCTATCTTCTCCCTACACTTAGCAGGAATCTCCTCAATCCTAGGGGCAATCAACTTTATCACCACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCCGTACTAATCACCGCAGTACTTCTCCTCCTATCACTTCCCGTCCTAGCCGCCGGTATCACCATGCTACTAACAGATCGCAATCTCAACACCACCTTCTTCGACCCAGCTGGAGGAGGAGACCCAGTACTCTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Notiochelidon cyanoleuca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blue-and-white swallow

The blue-and-white swallow (Notiochelidon cyanoleuca) is a passerine bird that breeds from Nicaragua south throughout South America, except in the deserts and the Amazon Basin. The southern race is migratory, wintering as far north as Trinidad, where it is a regular visitor. The nominate northern race may have bred on that island.[2]

Sometimes placed in the genus Pygochelidon,[3] it was first formally described as Hirundo cyanoleuca by French ornithologist Louis Vieillot in 1817, based on a specimen he believed to be from Paraguay.[4] The scientific name has the same meaning as the English common name.

Description[edit]

The adult blue-and-white swallow averages 11–12 cm (4.3–4.7 in) long and weighs about 10 g (0.35 oz). It has dark blue upperparts and white underparts, and its underwings and the undersurface of its short forked tail are blackish. The juvenile is brown above, buff-tinted below, and has a less forked tail. The call is a buzzing dzzzhreeee.[5]

There are three subspecies. The nominate N. c. cyanoleuca occurs from Nicaragua and Trinidad south to northwestern Argentina, Paraguay and Uruguay. The migratory southern race N. c. patagonica is larger (13.5 cm (5.3 in)), has paler underwings, and white basal undertail coverts. N. c. peruviana is restricted to coastal Peru up to 2,500 m (8,200 ft) altitude. It is smaller than patagonica, has less white in the undertail, darker underwings and duskier flanks.[5]

Ecology[edit]

This is a swallow of open areas including villages and towns, farms, and forest clearings. In Central America, it is a highland bird, but elsewhere in its range it can occur from the lowlands to an altitude of 4,000 m (13,000 ft).[5][6]

This species is often found in small flocks when not breeding. The blue-and-white swallow subsists primarily on a diet of insects, caught in the air; they have been seen to gather where termites swarm.[7] The flight is typically fluttery, and this swallow frequently perches on wires or branches.[5]

The blue-and-white swallow's shallow straw nest is built by both adults in a wide range of natural or man-made cavities include tree holes, rock crevices and bridges. The clutch is up to six white eggs in the south of the range, two or three in the north, which are incubated by both parents for 15 days to hatching. The nestlings are fed by both parents for 26 days to fledging, bur return to the nest to sleep with the parents for up to two months. There may be two broods.[5]

This common and popular species has benefited greatly from deforestation and human settlement which have increased the amount of suitable habitat and food.[5] Consequently, it is not considered threatened by the IUCN.[1][3]

References[edit]

  1. ^ a b BirdLife International (2012). "Pygochelidon cyanoleuca". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ ffrench, Richard; O'Neill, John Patton; Eckelberry, Don R. (1991). A guide to the birds of Trinidad and Tobago (2 ed.). Ithaca, N.Y.: Comstock Publishing. ISBN 0-8014-9792-2. 
  3. ^ a b "Species factsheet: Pygochelidon cyanoleuca". BirdLife International. 2014. Retrieved 12 July 2014. 
  4. ^ Vieillot, Louis Jean Pierre (1817). Nouveau dictionnaire d'histoire naturelle [New Dictionary of Natural History] (in French) 14 (nouvelle ed.). p. 509. 
  5. ^ a b c d e f Turner, Angela; Rose, Chris (1989). Swallows and martins: an identification guide and handbook. Houghton Mifflin. ISBN 0-395-51174-7. 
  6. ^ Stiles, F. Gary; Skutch, Alexander F. (1989). A Guide to the Birds of Costa Rica. Comstock Publishing Associates. ISBN 0-8014-9600-4. 
  7. ^ Olson, Storrs L.; Alvarenga, Herculano M.F. (2006). "An extraordinary feeding assemblage of birds at a termite swarm in the Serra da Mantiqueira, São Paulo, Brazil". Revista Brasileira de Ornitologia (Sociedade Brasileira de Ornitologia) 14 (3): 297–299. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!