Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: RESIDENT: from extreme southern Texas (Starr County) and northern Mexico south on Gulf-Caribbean slope of Middle America to western Panama, locally also on Pacific drainage in central Costa Rica.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 42 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Open woodland, forest edge, second-growth woodland, clearings, and plantations, primarily in humid habitats (AOU 1983). BREEDING: Nests in tree or shrub often far out on limb, usually 7-21 m above ground (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Clutch size 2-6 (usually 3) eggs. Incubation 18 days, by female. Young leave nest at 23-24 days. Immatures recorded in Texas in early June. Young from previous years may help tend nestlings (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Psilorhinus morio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cyanocorax morio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTGTACTTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCTCTAAGTCTTCTTATCCGAGCAGAACTAGGCCAACCCGGTTCCCTGCTAGGAGACGACCAAATCTACAATGTAATCGTTACAGCCCATGCCTTCGTTATAATCTTCTTCATAGTAATACCAATTATAATCGGAGGATTTGGAAACTGACTAGTACCCCTAATAATCGGTGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTTCTACCCCCATCATTCCTTCTACTCCTGGCCTCCTCAATAGTAGAAGCAGGAGTAGGAACAGGATGAACTGTATACCCCCCACTAGCCGGCAACCTGGCTCACGCCGGAGCTTCAGTTGATCTAGCCATCTTCTCACTACACCTAGCAGGTATTTCTTCCATCCTAGGAGCAATCAACTTCATCACCACAGCAATCAACATAAAACCCCCCGCCCTATCACAATACCAAACTCCCCTATTCGTATGATCCGTCCTAATTACTGCAGTACTACTACTTCTCTCCCTCCCCGTTCTAGCTGCCGGGATCACTATGCTTCTAACAGACCGTAACCTAAACACTACATTCTTTGACCCAGCTGGAGGAGGAGACCCAGTACTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyanocorax morio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brown jay

The brown jay (Psilorhinus morio) is a large American Jay which has the habitus of a magpie, but is slightly smaller and with a shorter tail, though the bill is larger.

It occurs from Mexico south into Central America on the Gulf slope. The northernmost extent of the bird is in the Rio Grande Valley of Texas.

Description[edit]

Sub-adult in Costa Rica

Brown jays vary in plumage geographically: there are two main groups. Northern birds are almost completely dark brown, with lighter brown on the underparts. Southern birds are white-bellied and have bright white tips to the outer tail feathers. The intergrade zone is in Veracruz, Mexico.

Adults in both populations have black bills, legs, and feet. Immatures have yellow bare parts, including yellow eye-rings.

The voice is a loud but low-pitched pee-ah call and is often modified to suit its situation or mood.

Ecology[edit]

Food is sought largely in trees but brown jays also take some food from the ground. They are rather indiscriminate feeders. Insects and a wide range of other invertebrates are taken, also lizards, nectar, and fruit (e.g. that of Trophis racemosa (Moraceae)).[2] Though they will take eggs and nestlings, they appear not to if there is plenty of other food available.

The nest is built in a tree or large shrub with both sexes helping in construction. There are normally three eggs laid but six is not unusual. Incubation is between 18 and 20 days. Only the female broods but the father feeds her while doing so.

Sometimes the young from another year will help in raising the chicks. If a helper bird returns with food, it will give it to one of the resident parents to feed the chicks.

Range[edit]

In Central America, the brown jay is not found in El Salvador; the range is on the Pacific side of Central America in Nicaragua, Costa Rica, and western Panama. It does not extend into South America.

References[edit]

  1. ^ BirdLife International (2012). "Psilorhinus morio". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Foster, Mercedes S. (2007). "The potential of fruiting trees to enhance converted habitats for migrating birds in southern Mexico". Bird Conservation International (BirdLife International) 17 (1): 45–61. doi:10.1017/S0959270906000554. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly merged with the genus Cyanocorax (AOU 1983, 1998), but now treated as separate on the basis of genetic and morphological data (AOU 2010 and sources cited therein).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!