Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Distribution

Geographic Range

Strix virgata is widely distributed throughout the Nearctic and Neotropics, from northern Mexico to Brazil and Argentina.

Biogeographic Regions: nearctic ; neotropical

  • 1999. Handbook of the Birds of the World. Vol. 5. Barn-owls to Hummingbirds. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Strix virgata individuals are medium-sized owls with brown eyes. They are mostly dark except for light brown facial markings. Mottled owls have yellow-grey to blue-grey bills and their toes are greyish-yellow. Their dorsal markings are much less noticeable than the vertical streaks on their chest and throat. They look larger than they are because of their thick feathers.

In owls, females are generally larger than the males. This evolution of a reversed size dimorphism has been explained in many different ways. Researchers measure body mass during the breeding season, wing length, tail length, bill length, tarsal length, and foot span. Female mottled owls weighed significantly more than males and have significantly longer wing chords. Strix virgata has the most noticable dimorphism yet documented among owls.

Range mass: 175 to 320 g.

Range length: 355 to 280 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabiting elevations between sea level and 2500 meters, mottled owls are often quite abundant within their range. Their habitats are extensive and diverse; they can live in a wide variety of forest and thicket edge, tropical rainforest, dry thorn forest, tropical lowland forest, pine-oak woodland, and humid evergreen jungle. They can also live in areas with scattered trees, often close to towns and villages.

Range elevation: 0 to 2500 m.

Habitat Regions: terrestrial

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Strix virgata individuals feed on a diverse diet including large insects such as beetles, grasshoppers, and cockroaches. They also feed on small mammals, birds, snakes, lizards, salamanders, and frogs. They are considered opportunistic feeders as they may be attracted to artificial lights. Mottled owls primarily hunt from perches which can be found along a forest edge.

Mottled owls have keen vision, hearing, and maneuverable flight, contributing to their success as predators. Although they lack color vision, these owls can rotate their heads to see in different directions. These owls also have sensitive ears that allow them to pinpoint sound sources in total darkness. Still, their ranges of hearing are not wide and contain deaf spots. Their wing feathers have adapted to dampen sound during flight, so they can approach their prey without being heard.

Animal Foods: birds; mammals; amphibians; reptiles; insects

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

This species is a generalist predator, and potentially impacts many prey populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Owls are at the top of the food web. They have no major predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

This species uses an array of vocalizations, such as hoots, whistles, screeches, screams, purrs, snorts, chitters, and hisses. When a mottled owl hoots, it is often territorial and associated with courting. The males have a lower pitched hoot than females. When faced with a threat, owls produce clicking noises with their tongues. As part of a mating display, owls have the ability to clap their wings in flight.

Mottled owls produce an array of calls. Their territorial call consists of a series of deep hoots, sounding like "bru bru" and "bu bu bu" or cowooawoo or keeooweeyo. They also have a whistled screech. Mottled owls have been observed to have an enlarged voice box which allows them to produce low-pitched notes for their size.

Owls have keen hearing and vision in low-light situations. They lack color vision.

Communication Channels: visual ; acoustic

  • Gerhardt, R. 1991. Response of Mottled Owls to Broadcast of Conspecific Call.. Journal of Field Ornithology, 62: 239-244.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is no information available regarding the lifespan of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mottled owls are monogamous, neither female nor male have any involvement with other nesting birds besides their mate.

Mating System: monogamous

Strix virgata have smaller clutches than ecologically similar or closely related species. This species usually lays 1 to 2 eggs between February and May. Mottled owls usually nest in holes of trees, tops of broken off palm and occasionally in empty nests of other birds.

Breeding interval: Mottled owls breed once yearly.

Breeding season: The breeding season occurs between February and May.

Range eggs per season: 1 to 2.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Females incubate eggs while males find food and bring it back to the nest. Both males and females care for the young.

Parental Investment: pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Protecting: Female); pre-independence (Provisioning: Male, Protecting: Female)

  • The British Ornithologists' Union. 1985. A Dictionary of Birds. South Dakota: Buteo Books.
  • Gerhardt, R., D. Gerhardt, C. Flatten. 1994. Breeding Biology and Home Range of Two Ciccaba Owls. Wilson Bulletin, 106: 629-639.
  • Gerhardt, , D. Gerhardt. 1987. Size, Dimorspism, and Related Characteristics of Ciccaba Owls From Guatemala. 2nd Owl Symposium: 190-196. Accessed September 22, 2004 at http://www.ncrs.fs.fed.us/pubs/gtr/other/gtr-nc190/GERHARD.PDF#xml.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ciccaba virgata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTCTTCGGCACATGAGCTGGCATAGTCGGCACCGCCCTTAGCTTACTCATCCGGGCCGAGCTAGGCCAACCCGGGACACTTCTGGGCGACGACCAGATCTACAATGTAATCGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATGGTCATGCCAATCATGATCGGAGGATTTGGAAACTGACTAGTTCCACTAATAATCGGAGCTCCAGACATGGCCTTCCCCCGTATAAACAACATAAGCTTCTGACTTCTACCACCCTCATTCCTACTCCTGCTAGCCTCCTCCACAGTAGAGGCCGGAGCAGGCACCGGATGAACTGTCTACCCCCCACTAGCCAGCAACCTAGCCCACGCTGGAGCCTCAGTAGACCTAGCCATTTTTTCCCTCCATCTAGCAGGGGTATCCTCCATCCTCGGGGCAATCAACTTCATCACCACTGCCATCAACATAAAACCCCCATCTCTGTCACAGTACCAAACTCCCCTGTTTGTCTGATCCGTCCTCATCACCGCCATTCTTCTACTCCTGTCGCTCCCAGTCCTTGCTGCAGGCATCACCATACTATTAACTGACCGCAACCTAAACACCACATTCTTCGATCCTGCCGGCGGAGGTGACCCAGTCCTTTATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ciccaba virgata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This widespread species is not globally threatened. Strix virgata are considered common in many habitats and can be seen largely in protected areas.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 500,000-4,999,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of Strix virgata on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mottled owls have been studied by scientists and research has been published on their breeding behavior. They also help control some rodent and insect pest populations.

Positive Impacts: research and education; controls pest population

  • Wylie , S. 1976. Breeding the Mottled Owl at the St. Louis Zoo. The Avicultural Magazine, 82: 64-65.
  • 1994. The Food Habits of Sympatric Ciccaba Owls in Northern Guatemala.. Journal of Field Ornithology, 65: 258-264.
  • Buchanan, M. 1971. The Mottled Owl Ciccaba Virgata in Trinidad.. Ibis, 113: 105-106.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mottled owl

The mottled owl (Strix virgata) is a medium-sized owl found in Central and South America from Mexico to Brazil and Argentina. The head and back are mottled brown and the underparts whitish, with vertical bars on the chest and throat. The eyes are dark and the head is round and they do not have ear tufts. They are territorial and found in dry forests and jungles up to 2,500 m (8,200 ft) above sea level.

Taxonomy[edit]

The mottled owl was first described in 1849 by John Cassin as Ciccaba virgata. In 1999, Wink and Heidrich transferred it to the genus Strix, but this is still contested by some authorities.[2]

Description[edit]

The mottled owl is a medium-sized owl with adults reaching 280 to 355 mm (11.0 to 14.0 in) in length. Females are considerably larger than males; the mottled owl shows the greatest degree of sexual dimorphism of any species of owl.[3] The crown, nape and back are mottled in several shades of darkish brown, the facial disc is pale brown and the throat, breast and belly are off-white with distinctive vertical brown streaks. The large eyes are brown, the beak is greyish-yellow or greyish-blue, and the legs and feet are greyish-yellow. There is a darker form of the bird with a buff breast and belly. Mottled owls produce a range of calls which include a hoot used in maintaining territory boundaries, and various whistles, screeches and hisses.[3][4]

Distribution and habitat[edit]

The mottled owl is native to Central and South America. Its range extends from Mexico south to Argentina and Brazil and it is found at elevations up to about 2,500 m (8,200 ft). It inhabits a variety of wooded habitats including rainforest, woodland verges, dry thorn forest, pine/oak woodland and plantations and also open countryside with scattered trees. In some parts of its range it is common and it is often found close to human habitations.[3]

Behaviour[edit]

The mottled owl is nocturnal and spends the day in dense vegetation where it may be mobbed by other birds. Its large eyes are adapted for sight at low levels of light, and its hearing is also acute. It is a predator and at night often perches on a branch beside a glade or at the edge of woodland on the lookout for prey. When it detects a small moving object, it swoops down from its perch on silent wings and pounces on its target, which may be a small mammal, a bird, reptile or amphibian or a large beetle, grasshopper or other insect.[3]

The mottled owl breeds between February and May in Colombia and in September to November in Argentina. It usually nests in a hole in a tree but may also choose an empty nest built by another species. One or usually two white eggs are laid and incubated by the female and both parents care for the young.[4]

Status[edit]

The mottled owl has a very wide range and the number of individual birds has been estimated to be somewhere between five hundred thousand and five million. It is listed by the IUCN as being of "Least Concern" on the basis that, though its numbers may be decreasing slightly, they are not doing so at such a rate as would justify putting the bird in a more vulnerable category.[1]

References[edit]

  1. ^ a b BirdLife International (2012). "Strix virgata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Remsen, J.V., Jr.; Cadena, C.D.; Jaramillo, A.; Nores, M.; Pacheco, J.F.; Pérez-Emán, J.; Robbins, M.B.; Stiles, F.G.; Stotz, D.F.; Zimmer, K.J. "A classification of the bird species of South America". Version: 23 July 2014. South American Classification Committee, American Ornithologists' Union. 
  3. ^ a b c d Fetter, Jess (2004). "Strix virgata: Mottled Owl". Animal Diversity Web. University of Michigan. Retrieved 13 October 2013. 
  4. ^ a b König, Claus; Becking, Jan-Hendrik (2009). Owls of the World. A. C. Black. pp. 366–368. ISBN 9781408108840. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!