Overview

Distribution

The Alpine Swift can be found throughout southern Europe, from Portugal to Bulgaria, and throughout all of Africa. In Europe, its main breeding area extends northward from Greece, ending just short of Germany. It is also vagrant to the British Isles and some parts of central and northern Europe. (Peterson et al. 1993, Harrison and Greensmith 1993)

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

With a length of 21 centimeters and a wingspan of 53 centimeters, Tachymarptis melba is the largest known swift. It is thick-set with a short, forked tail. The plumage on its back is umber-brown, while its throat and belly are white. A dark pectoral band is also visible. (Peterson et al. 1993, Bologna 1978)

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The Alpine Swift usually resides in high, rocky, mountainous areas, but the rocky regions of sea cliffs are also an acceptable habitat for the swift. It can also be found living among the old buildings of a town or city. (Bologna 1978, Peterson et al. 1993)

Terrestrial Biomes: mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The Alpine Swift feeds exclusively on insects that it catches while in flight. While feeding, it courses back and forth with its huge mouth open, collecting the insects in its path. It will feed indiscriminately on any flying insects that it can get into its mouth. (Bologna 1978, Encyclopedia Britannica 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 26 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The Alpine Swift rears its young in a cup-shaped nest. This nest is usually built of feathers, fibers, sticks, plant down, and moss. The swift's saliva is used as the glue that holds the nest together. The nest is usually glued to the vertical surfaces of rock cracks and the eaves of houses, with the saliva once again serving as the glue. The swift will lay a single clutch of one to four eggs, though three is the usual number. Both parents incubate the eggs for eighteen to thirty-three days. The nestlings are hatched naked, and they are reared for another six to ten weeks, not leaving the nest until they have acquired adult plumage. (Bologna 1978, Encyclopedia Britannica 1999, Gilliard 1967)

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tachymarptis melba

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACTTAATCTTTGGAGCATGAGCCGGCATAGTCGGAACTGCCCTCAGCCTACTTATCCGAGCAGAACTTGGACAACCAGGGACCCTCCTAGGAGATGACCAAATCTACAACGTCATCGTAACCGCCCATGCTTTCGTCATAATCTTCTTCATAGTCATACCCATCATAATTGGAGGATTTGGAAACTGACTAGTTCCCCTCATAATCGGCGCACCCGACATAGCATTCCCCCGAATAAACAATATAAGCTTCTGATTACTTCCCCCATCATTCCTACTCCTCCTAGCCTCCTCAACAGTAGAAGCAGGGGCAGGAACAGGCTGAACTGTATACCCCCCTTTAGCAGGTAACCTAGCCCACGCAGGTGCATCAGTAGACCTTGCCATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCCATCCTAGGTGCAATCAACTTCATTACTACTGCTATCAACATAAAACCCCCTGCCCTTTCACAATATCAAACACCCCTATTCGTATGATCCGTCCTCATCACCGCCGTCCTACTACTTCTCTCCCTCCCCGTCCTTGCCGCTGGCATCACCATACTCCTAACTGACCGCAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTTTACATCCTAATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tachymarptis melba

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Migrant breeder, regular passage visitor and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 140000-330000 breeding pairs, equating to 420000-990000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 1000000-4000000 individuals, although further validation of this estimate is needed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The Alpine Swift will sometimes nest in the eaves of houses. This can create an annoyance for most homeowners, and it could cause some damage to the house as well. These nests can also be viewed by some people as an eyesore to the neighborhood. (Bologna 1978)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

By feeding exclusively on insects, the Alpine Swift reduces the number of these pests that are irritating or harmful to humans. (Bologna 1978)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Alpine swift

The Alpine swift (Tachymarptis melba) or Apus melba, is a species of swift. Alpine swifts breed in mountains from southern Europe to the Himalaya. Like common swifts, they are strongly migratory, and winter much further south in southern Africa.

Swifts have very short legs which are used for clinging to vertical surfaces. The scientific name comes from the Ancient Greek απους, apous, meaning "without feet". They never settle voluntarily on the ground, spending most of their lives in the air living on the insects they catch in their beaks. Alpine swift are able to stay aloft in the air for up to seven months at a time, even drinking water "on the wing". Their vital physiological processes, including sleep, can be performed while in continuous flight.

Description and biology[edit]

The bird is superficially similar to a large barn swallow or house martin. It is, however, completely unrelated to those passerine species, since swifts are in the order Apodiformes. The resemblances between the groups are due to convergent evolution, reflecting similar life styles.

Swifts have very short legs which they use only for clinging to vertical surfaces. The scientific name comes from the Ancient Greek απους, apous, meaning "without feet". They never settle voluntarily on the ground.

Alpine swifts breed in mountains from southern Europe to the Himalaya. Like common swifts, they are strongly migratory, and winter much further south in southern Africa. They wander widely on migration, and are regularly seen in much of southern Europe and Asia. The species seems to have been much more widespread during the last ice age, with a large colony breeding, for example in the Late Pleistocene Cave No 16, Bulgaria, around 18,000–40,000 years ago.[2] The same situation has been found for Komarowa Cave near Częstochowa, Poland during a period about 20,000–40,000 years ago.[3]

Alpine Swift call
The call is a drawn-out twittering.

Problems playing this file? See media help.

These apodiformes build their nests in colonies in a suitable cliff hole or cave, laying 2–3 eggs. Swifts will return to the same sites year after year, rebuilding their nests when necessary, and pairing for life. Young swifts in the nest can drop their body temperature and become torpid if bad weather prevents their parents from catching insects nearby. They have adapted well to urban conditions, frequently nesting in old buildings in towns around the Mediterranean, where large, low-flying flocks are a familiar feature in summer.

Alpine swifts are readily distinguished from the common swifts by their larger size and their white belly and throat. They are around twice as big as most other swifts in its range, about 20 to 23 cm (7.9 to 9.1 in) in length, with a wingspan of 57 cm (22 in) and a weight of around 100 g (3.5 oz).[4] They're largely dark brown in colour, with white patches underneath the beak and on the breast that are separated by a dark brown streak. Juveniles are similar to adults, but their feathers are pale edged.[5]

In comparison, the common swift has a wingspan of around 42 cm (17 in). A dark neck band separates the white throat from the white belly. They have a short forked tail and very long swept-back wings that resemble a crescent or a boomerang but may (as in the image) be held stretched straight out. Their flight is slower and more powerful than that of their smaller relative, with a call that is a drawn-out twittering (listen at right).

Life on the wing[edit]

Alpine swifts spend most of their lives in the air, living on the insects they catch in their beaks. They drink on the wing, but roost on vertical cliffs or walls. A study published in 2013 showed Alpine swifts can spend over six months flying without having to land.[6] All vital physiological processes, including sleep, can be performed while on air.

In 2011, Felix Liechti and his colleagues at the Swiss Ornithological Institute attached electronic tags that log movement to six alpine swifts and it was discovered that the birds could stay aloft in the air for more than 200 days straight.[7]

References[edit]

  1. ^ BirdLife International (2012). "Tachymarptis melba". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Boev, Z. 1998. A range fluctuation of Alpine swift (Apus melba (L., 1758)) (Apodidae - Aves) in Nothern Balkan Peninsula in the Riss-Wurm interglacial. - Biogeographia, Nuova Serie, Siena, Vol. 19, 1997: pp. 213–218.
  3. ^ Tomek, Teresa & Bocheński, Zygmunt (2005): "Weichselian and Holocene bird remains from Komarowa Cave, Central Poland". Acta zoologica cracoviensia, Vol. 48A, (1-2): pp. 43–65.
  4. ^ BTO Birdfacts - Alpine swift, British Trust for Ornithology, BTO.org website.
  5. ^ Stevenson & Fanshawe. Field Guide to the Birds of East Africa: Kenya, Tanzania, Uganda, Rwanda, Burundi, Elsevier Science, 2001, ISBN 978-0856610790.
  6. ^ Felix Liechti; Willem Witvliet; Roger Weber; Erich Bächler. "First evidence of a 200-day non-stop flight in a bird", Nature website, Nature Communications, article number: 2554, received 11 January 2013, published: 8 October 2013, doi: 10.1038/ncomms3554 (subscription).
  7. ^ Stromberg, Joseph. This Bird Can Stay in Flight for Six Months Straight: A lightweight sensor attached to alpine swifts reveals that the small migratory birds can remain aloft for more than 200 days without touching down, Smithsonian Magazine website, 8 October 2013.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!