Overview

Distribution

The Alpine Swift can be found throughout southern Europe, from Portugal to Bulgaria, and throughout all of Africa. In Europe, its main breeding area extends northward from Greece, ending just short of Germany. It is also vagrant to the British Isles and some parts of central and northern Europe. (Peterson et al. 1993, Harrison and Greensmith 1993)

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

With a length of 21 centimeters and a wingspan of 53 centimeters, Tachymarptis melba is the largest known swift. It is thick-set with a short, forked tail. The plumage on its back is umber-brown, while its throat and belly are white. A dark pectoral band is also visible. (Peterson et al. 1993, Bologna 1978)

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Alpine Swift usually resides in high, rocky, mountainous areas, but the rocky regions of sea cliffs are also an acceptable habitat for the swift. It can also be found living among the old buildings of a town or city. (Bologna 1978, Peterson et al. 1993)

Terrestrial Biomes: mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The Alpine Swift feeds exclusively on insects that it catches while in flight. While feeding, it courses back and forth with its huge mouth open, collecting the insects in its path. It will feed indiscriminately on any flying insects that it can get into its mouth. (Bologna 1978, Encyclopedia Britannica 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 26 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The Alpine Swift rears its young in a cup-shaped nest. This nest is usually built of feathers, fibers, sticks, plant down, and moss. The swift's saliva is used as the glue that holds the nest together. The nest is usually glued to the vertical surfaces of rock cracks and the eaves of houses, with the saliva once again serving as the glue. The swift will lay a single clutch of one to four eggs, though three is the usual number. Both parents incubate the eggs for eighteen to thirty-three days. The nestlings are hatched naked, and they are reared for another six to ten weeks, not leaving the nest until they have acquired adult plumage. (Bologna 1978, Encyclopedia Britannica 1999, Gilliard 1967)

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tachymarptis melba

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACTTAATCTTTGGAGCATGAGCCGGCATAGTCGGAACTGCCCTCAGCCTACTTATCCGAGCAGAACTTGGACAACCAGGGACCCTCCTAGGAGATGACCAAATCTACAACGTCATCGTAACCGCCCATGCTTTCGTCATAATCTTCTTCATAGTCATACCCATCATAATTGGAGGATTTGGAAACTGACTAGTTCCCCTCATAATCGGCGCACCCGACATAGCATTCCCCCGAATAAACAATATAAGCTTCTGATTACTTCCCCCATCATTCCTACTCCTCCTAGCCTCCTCAACAGTAGAAGCAGGGGCAGGAACAGGCTGAACTGTATACCCCCCTTTAGCAGGTAACCTAGCCCACGCAGGTGCATCAGTAGACCTTGCCATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCCATCCTAGGTGCAATCAACTTCATTACTACTGCTATCAACATAAAACCCCCTGCCCTTTCACAATATCAAACACCCCTATTCGTATGATCCGTCCTCATCACCGCCGTCCTACTACTTCTCTCCCTCCCCGTCCTTGCCGCTGGCATCACCATACTCCTAACTGACCGCAACCTAAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTTTACATCCTAATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tachymarptis melba

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5