Articles on this page are available in 2 other languages: Chinese (Simplified) (6), Spanish (4) (learn more)

Overview

Brief Summary

Biology

The kingfisher feeds mainly on fish and invertebrates, which it catches by perching on a convenient branch or other structure overhanging the water, and plunging into the water when suitable prey comes within striking distance (2). If a suitable perch is not present, individuals may hover over the water whilst searching for prey (2). During the breeding season, pairs perform a display flight whilst calling. The nest consists of a tunnel in a riverbank or amongst the roots of a tree; both sexes help to excavate the tunnel, which terminates in a rounded chamber. In April or May 6-7 whitish eggs are laid on the bare earth, but after some time regurgitated fish bones form a lining to the nest chamber. Both parents incubate the eggs for 19-21 days. The young fledge after around 23-27 days, before this time they may eagerly approach the entrance of the tunnel when waiting to be fed (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The beautiful iridescent plumage of the kingfisher makes it one of our most colourful and instantly recognisable birds; despite this it is rarely seen due to its shy nature (2). The upperparts are bright blue, while the underparts are a rich chestnut-red (4), although if seen in flight these colours may not be very obvious (8). The bill is very long and dagger-like (4). Although the sexes are generally similar, in breeding pairs they can be distinguished by the bill; in females it has a red base, whereas in males it is completely black (2). Although similar to adults, juveniles have duller, greener plumage (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Alcedo atthis is found throughout Europe and Asia as far east as Japan. They are also found in Africa, south of the Sahara. Common kingfishers are year long residents in their southern habitats, while northern populations travel south during the winter to escape freezing water. Alcedo atthis is the only species of kingfisher in much of its European range.

Biogeographic Regions: palearctic (Native ); oriental (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

In Britain, this species is widespread (4); its stronghold is central and southern England (5), becoming scarce in Scotland (4). Until the mid 1980s, the kingfisher underwent a decline in both range and numbers in its main habitat of linear waterways. Since then, it seems to have experienced a recovery, however it is not yet clear if this recovery is complete (6). Elsewhere, this species is found across Europe, and in most of Asia, reaching as far east as Japan. It also occurs in Africa south of the Sahara (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Common kingfishers are reknowned for their iridescent blue plumage. The entire upper portion of the bird: wings, back, and head are completely blue. The underbelly and a small patch underneath the eyes are rich chestnut. The throat and a small part of the side of the neck is bright white. They have small red feet. Their beaks are long, sharp and strong for the purpose of catching and holding prey. Males and females are very similar except for their beaks. A male’s beak is jet black, while the lower half of a female’s beak is chestnut. Juvenile’s are slightly more green and duller than adults.

Range mass: 26 to 39 g.

Average mass: 34 g.

Average length: 17 cm.

Range wingspan: 24 (low) cm.

Average wingspan: 26 cm.

Average basal metabolic rate: 0.3780 cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

Average basal metabolic rate: 0.378 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common kingfishers are found on the shores of lakes, ponds, streams, and in wetlands. They have even been known to fish in brackish waters, especially during the winter months, when other bodies of water may be frozen.

Range elevation: 0 to 190 m.

Habitat Regions: temperate ; terrestrial ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: riparian ; estuarine

  • Bannerman, D. 1955. The Birds Of The British Isles. Edinburgh: Tweedale Court London: 39a Welbeck Street: Oliver and Boyd LTD..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

May inhabit all types of fresh water, including ponds, canals, rivers and streams (4). It may also exploit brackish waters on the coast and marshes (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Common kingfishers hunt for prey from a perch above the water. Perches may be several centimeters to several meters above the water. When they see potential prey, they dive into the water, grab the prey, and fly back out. Sometimes when a perch is unavailable they will hover above the water to search for prey. After catching a fish, common kingfishers will hold the prey by its tail, and whack it against the perch. This stuns or kills the prey, which is particularly important when eating fish with spines. After consuming a fish it will regurgitate a pellet of indigestible bone.

Common kingfishers eat mostly small fish, making up 60-67% of their diet. They may also eat small arthropods, such as Gammarus fasciatus. Crustacea consist of 5-33% of their diet. Common kingfishers have also been known to eat crabs and other small marine animals during the winter.

Animal Foods: fish; insects; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Kingfishers are a good indicator of ecosystem health. Because kingfishers eat small aquatic animals, they are severely effected by toxins in the water. A strong kingfisher population usually means a healthy enviroment. Common kingfishers are important predators on small fish in freshwater habitats throughout their range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Common kingfishers have few natural predators as adults.  However, because they are high on the food chain, they are susceptible to the effects of bioaccumulation, the concentration of pollutants as they climb the food chain. Nestlings may be preyed on by snakes and other ground-dwelling predators, but kingfishers are aggressive birds and do defend their young against predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Common kingfishers have advanced eyesight, with the ability to polarize light, reducing the reflection of light off of water. They also learn to compensate for refraction, allowing them to catch prey more effectively. Common kingfishers communicate vocally. They are well known for their long, trilling call which sounds like a repetition of “chee”. When mating, a male will whistle loudly to a female and chase her above and through the trees. In a dive for prey, a membrane covers their eyes and they rely solely on touch to know when to snap their jaws shut.

Communication Channels: visual ; acoustic

Perception Channels: polarized light

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Common kingfishers can live for as long as 15 years. The average lifespan is 7 years. However, the first months of development are the most dangerous with only 50% of the young surviving to adulthood.

Range lifespan

Status: wild:
21 (high) years.

Average lifespan

Status: wild:
7 years.

Average lifespan

Status: captivity:
21 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating is the only time that Alcedo atthis individuals are not solitary. At the beginning of the mating season, males will chase females through the trees, producing a loud whistle. Common kingfishers will find a new mate each year. Mating only occurs in the warmer months of the year, starting in April and ending sometimes as late as October.

Mating System: monogamous

In about mid-March nesting begins. The male and female work together to dig a hole into a bank along a water source. Common kingfishers prefer steep banks. The holes are of various depths and are dug into various types of soil. Usually a hole between 15 and 30 cm long is dug, but on occasion some as deep as 1.2 meters have been discovered. They may nest in clay, rock, or sandy ground. Nests also vary in the distance they are above the water, with the distance varying from 0.5 to 37 meters above the water level.

Both parents will raise and feed the young. However, the female will do most of the work. Common kingfishers will brood 2 to 3 clutches a year. These clutches consist usually of 6 or 7 eggs, but there may be as many as 10.

Breeding interval: Common kingfishers have 2-3 clutches yearly, one in April, another by July, and sometimes, a final clutch in early October.

Breeding season: Breeding occurs from early April until early October.

Range eggs per season: 4 to 10.

Average eggs per season: 6.

Range time to hatching: 18 to 21 days.

Range fledging age: 23 to 27 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both males and females help to raise the young. For 19-21 days they incubate the eggs. Both will incubate during the day, only the female at night. Both have active roles in brooding and feeding the young, but the female does most of the work. One parent will hunt, then return with a fish exactly the right size for the young, they will also hold it by the tail so that the young can swallow the fish head first. When the young are able, they will eagerly wait at the opening of the burrow to be fed. After 23-27 days the young fledge and emerge from the nest.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Structures create colorful feathers: common kingfisher
 

Feathers of the common kingfisher create colorful feathers due to pigment granules, spongy nanostructures, and thin films.

   
  "The bright colours of the common kingfisher Alcedo atthis are created by two types of feather barb: one filled with pigment granules and the other with quasi-ordered channel-type keratinous sponges. A broad-band background reflection is added by the cortex of the shiny feathers, especially when the feathers are illuminated from oblique directions." (Stayenga et al. 2011:3966)
  Learn more about this functional adaptation.
  • Stavenga DG; Tinbergen J; Leertouwer HL; Wilts BD. 2011. Kingfisher feathers – colouration by pigments, spongy nanostructures and thin films. The Journal of Experimental Biology. 214: 3960-3967.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Beak provides streamlining: common kingfisher
 

The beak of kingfishers allows splashless entry into water due to the wedge shape it makes with the head that is round in cross section.

     
  "[W]e had another challenge that we pursued to the test run phase. Half of the entire Sanyo Shinkansen Line (from Osaka to Hakata) is made up of tunnel sections. When a train rushes into a narrow tunnel at high speed, this generates atmospheric pressure waves that gradually grow into waves like tidal waves. These reach the tunnel exit at the speed of sound, generating low-frequency waves that produce a large boom and aerodynamic vibration so intense that residents 400 meters away have registered complaints. For this reason, we gave up doing test runs at over 350 km/h.

"Then, one of our young engineers told me that when the train rushes into a tunnel, he felt as if the train had shrunk. This must be due to a sudden change in air resistance, I thought. The question the occurred to me - is there some living thing that manages sudden changes in air resistance as a part of daily life?

"Yes, there is, the kingfisher. To catch its prey, a kingfisher dives from the air, which has low resistance, into high-resistance water, and moreover does this without splashing. I wondered if this is possible because of the keen edge and streamlined shape of its beak.

"So we conducted tests to measure pressure waves arising from shooting bullets of various shapes into a pipe and a thorough series of simulation tests of running the trains in tunnels, using a space research super-computer system. Data analysis showed that the ideal shape for this Shinkansen is almost identical to a kingfisher's beak.

"I was once again experiencing what it is to learn from Nature, seeing first hand that a solution obtained through large-scale tests and analysis by a state-of-the-art super-computer turned out to be very similar to a shape developed by a living creature in the natural world. The nose of our new 500-Series Shinkansens has a streamline shape that is 15m in length and almost round in cross section.

"This shape has enabled the new 500-series to reduce air pressure by 30% and electricity use by 15%, even though speeds have increased by 10% over the former series. Another benefit has been confirmed through a favorable reputation among customers that these trains give a comfortable ride. This is due to the fact that changes in pressure when the trains enter tunnels are smaller." (Japan for Sustainability 2005)

  Learn more about this functional adaptation.
  • Japan for Sustainability. 2005. Shinkansen Technology Learned from an Owl? The story of Eiji Nakatsu. Japan for Sustainability Newsletter [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alcedo atthis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTCTCCAACCACAAAGACATTGGCACTTTATACCTAATCTTCGGCGCATGAGCCGGCATAGTCGGCACCGCCCTAAGCCTACTCATCCGCGCCGAACTAGGTCAACCAGGCACACTCTTAGGGGATGACCAAATCTACAACGTAATCGTCACCGCCCATGCCTTCGTCATAATCTTCTTCATAGTCATACCCATCATAATCGGCGGGTTTGGAAATTGACTTGTCCCCCTAATAATCGGAGCCCCAGACATGGCATTTCCCCGCATAAACAACATAAGCTTCTGACTCCTTCCACCATCCCTCCTATTACTCCTAGCCTCCTCTACAGTTGAAGCAGGAGCTGGCACAGGCTGAACTGTATACCCCCCCCTAGCCGGCAACCTCGCCCACGCTGGACCTTCAGTAGACTTAGCCATCTTTTCACTTCACTTAGCAGGAGTATCCTCCATCCTAGGGGCAATTAACTTTATCACAACCGCTACCAACATAAAACCCCCAGCCCTCTCCCAATACCAAACTCCACTTTTCGTGTGATCCGTACTAATTACCGCCGTACTTCTCCTCCTATCACTACCGGTCCTTGCCGCTGGCATTACAATATTATTAACAGACCGCAACCTAAATACCACTTTCTTCGACCCCGCTGGAGGAGGAGATCCAATCCTATACCAACACTTATTCTGATTCTTCGGCCATCCCGAGGTCTACATCCTAATCCTCCCAGGATTTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alcedo atthis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common kingfishers are not listed as a concern for many of the top conservation sites. However, common kingfishers do undergo large fluctuations in populations on a yearly basis. This is due mostly to severe cold. In one census, after a severe winter in Belgium there were only 8 pairs, five years later there were 45, but reduced to 25 the following year.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder, regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Specially protected under Schedule 1 of the Wildlife and Countryside Act, 1981 (3). Included in the Birds of Conservation Concern Amber List (medium conservation concern) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The kingfisher population undergoes fluctuations, but there is no long-term trend in numbers. It is vulnerable to spells of severe winter weather, since when water bodies freeze over kingfishers are unable to feed (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The kingfisher is fully protected under Schedule 1 of the Wildlife and Countryside Act, 1981 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Anglers once considered Alcedo atthis a threat to trout populations. However, only 7-28% of the fish that common kingfishers eat are trout fry. Common kingfishers have been known to poach fish farms, but are not numerous enough to cause significant economic losses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Common kingfishers are important members of ecosystems and good indicators of freshwater community health.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common Kingfisher

The Common Kingfisher (Alcedo atthis) also known as Eurasian Kingfisher or River Kingfisher, is a small kingfisher with seven subspecies recognized within its wide distribution across Eurasia and North Africa. It is resident in much of its range, but migrates from areas where rivers freeze in winter.

This sparrow-sized bird has the typical short-tailed, large-headed kingfisher profile; it has blue upperparts, orange underparts and a long bill. It feeds mainly on fish, caught by diving, and has special visual adaptions to enable it to see prey under water. The glossy white eggs are laid in a nest at the end of a burrow in a riverbank.

Contents

Taxonomy [edit]

This species was first described by Carl Linnaeus in his Systema Naturae in 1758 as Gracula atthis.[2] The modern binomial name derives from the Latin alcedo, "kingfisher" (from Greek ἀλκυών, halcyon) and Atthis, a beautiful young woman of Lesbos, and favourite of Sappho.[3]

The genus Alcedo comprises a number of small, exclusively fish-eating kingfishers. The Common Kingfisher’s closest relatives in the genus are three similar blue-backed, orange-breasted species, the Blue-eared, Half-collared and Blyth's Kingfishers.[4]

Description [edit]

This species has the typical short-tailed, dumpy-bodied large-headed and long-billed kingfisher shape. The adult male of the western European subspecies, A. a. ispida has green-blue upperparts with pale azure-blue back and rump, a rufous patch by the bill base, and a rufous ear-patch. It has a green-blue neck stripe, white neck blaze and throat, rufous underparts, and a black bill with some red at the base. The legs and feet are bright red.[5] It is about 16 centimetres (6.3 in) long with a wingspan of 25 cm (9.8 in),[5] and weighs 34–46 grams (1.2–1.6 oz).[6]

The female is identical in appearance to the male except that her lower mandible is orange-red with a black tip. The juvenile is similar to the adult, but with duller and greener upperparts and paler underparts. Its bill is black, and the legs are also initially black.[5]

The flight of the Kingfisher is fast, direct and usually low over water. The short rounded wings whirr rapidly, and a bird flying away shows an electric-blue "flash" down its back.[6]

In North Africa, Europe and Asia north of the Himalayas this is the only small blue kingfisher. In south and southeast Asia it can be confused with six other small blue-and-rufous kingfishers, but the rufous ear patches distinguish it from all but juvenile Blue-eared Kingfisher; details of the head pattern may be necessary to differentiate the two species where both occur.[5]

The Common Kingfisher has no song. The flight call is a short sharp whistle, chee, repeated two or three times. Anxious birds emit a harsh, shrit-it-it and nestlings call for food with a churring noise.[5]

Geographical variation [edit]

A. a. bengalensis in Japan

There are seven subspecies differing in the hue of the upperparts and the intensity of the rufous colour of the underparts; size varies across the subspecies by up to 10%. The races resident south of the Wallace Line have the bluest upperparts and partly blue ear-patches.[5]

  • A. a. ispida (Linnaeus, 1758).[7] Breeds from south Norway, Ireland and Spain to western Russia and Romania and winters south to southern Portugal and Iraq.
  • A. a. atthis (Linnaeus, 1758). Breeds from northwestern Africa and southern Italy east to Afghanistan, Kashmir region, north Xinjiang, and Siberia; it is a winter visitor south to Israel,[8] northeastern Sudan, Yemen, Oman and Pakistan. Compared to A. a. ispida, it has a greener crown, paler underparts and is slightly larger.
  • A. a. bengalensis (Gmelin, 1788). Breeds in south and east Asia from India to Indonesia, China, Korea, Japan and eastern Mongolia; winters south to Indonesia and the Philippines. It is smaller and brighter than the European races.
  • A. a. taprobana (Kleinschmidt, 1894). Resident breeder in Sri Lanka and southern India. Its upperparts are bright blue, not green-blue; it is the same size as A. a. bengalensis.
  • A. a. floresiana (Sharpe, 1892). Resident breeder from Bali to Timor. Like A. a. taprobana, but the blues are darker and the ear-patch is rufous with a few blue feathers.
  • A. a. hispidoides (Lesson 1837). Resident breeder from Sulawesi to New Guinea and the islands of the western Pacific Ocean Plumage colours are deeper than in A. a. floresiana, the blue on the hind neck and rump is purple-tinged and the ear-patch is blue.
  • A. a. solomonensis (Rothschild & Hartert 1905). Resident breeder in the Solomon Islands east to San Cristobal. The largest Southeast Asian subspecies. It has a blue ear-patch and is more purple-tinged than A. a. hispidoides, with which it interbreeds.

Habitat and distribution [edit]

In India, resident A. a. taprobana (left) and migrant A. a. bengalensis (right) may both be present in winter.

The Common Kingfisher is widely distributed over Europe, Asia, and North Africa, mainly south of 60°N. It is a common breeding species over much of its vast Eurasian range, but in North Africa it is mainly a winter visitor, although it is a scarce breeding resident in coastal Morocco and Tunisia. In temperate regions, this kingfisher inhabits clear, slow-flowing streams and rivers, and lakes with well-vegetated banks. It frequents scrubs and bushes with overhanging branches close to shallow open water in which it hunts. In winter it is more coastal, often feeding in estuaries or harbours and along rocky seashores. Tropical populations are found by slow-flowing rivers, in mangrove creeks and in swamps.[5]

Common Kingfishers are important members of ecosystems and good indicators of freshwater community health. The highest densities of breeding birds are found in habitats with clear water, which permits optimal prey visibility, and trees or shrubs on the banks. These habitats have also the highest quality of water, so the presence of this bird confirms the standard of the water.[9] Measures to improve water flow can disrupt this habitat, and in particular, the replacement of natural banks by artificial confinement greatly reduces the populations of fish, amphibians and aquatic reptiles, and waterside birds are lost.[10] It can tolerate a certain degree of urbanisation, provided the water remains clean.

This species is resident in areas where the climate is mild year-round, but must migrate after breeding from regions with prolonged freezing conditions in winter. Most birds winter within the southern parts of the breeding range, but smaller numbers cross the Mediterranean into Africa or travel over the mountains of Malaysia into Southeast Asia. Kingfishers migrate mainly at night, and some Siberian breeders must travel at least 3,000 km (1,900 mi) between the breeding sites and the wintering areas.[5]

Behaviour [edit]

Breeding [edit]

Volunteers create a vertical bank in which Common Kingfishers have subsequently nested annually.

Like all kingfishers, the Common Kingfishers is highly territorial; since it must eat around 60% of its body weight each day, it is essential to have control of a suitable stretch of river. It is solitary for most of the year, roosting alone in heavy cover. If another kingfisher enters its territory, both birds display from perches, and fights may occur, where a bird will grab the other's beak and try to hold it under water. Pairs form in the autumn but each bird retains a separate territory, generally at least 1 km (0.62 mi) long, but up to 3.5 km (2.2 mi) and territories are not merged until the spring.[5]

The courtship is initiated by the male chasing the female while calling continually, and later by ritual feeding, copulation usually following.[6]

The nest is in a burrow excavated by both birds of the pair in a low vertical riverbank, or sometimes a quarry or other cutting. The straight, gently inclining burrow is normally 60–90 cm (24–36 in) long and ends in an enlarged chamber.[6] The nest cavity is unlined but soon accumulates a litter of fish remains and cast pellets.[11]

The Common Kingfisher typically lays five to seven (range two to ten) glossy white eggs, which average 1.9 cm (0.75 in) in breadth, 2.2 cm (0.87 in) in length, and weigh about 4.3 g (0.15 oz), of which 5% is shell.[3] One or two eggs in most clutches fail to hatch because the parent cannot cover them. Both sexes incubate by day, but only the female at night. An incubating bird sits trance-like, facing the tunnel; it invariably casts a pellet, breaking it up with the bill. The eggs hatch in 19–20 days, and the altricial young are in the nest for a further 24–25 days, often more.[4] Once large enough, young birds will come to the burrow entrance to be fed.[11] Two broods, sometimes three, may be reared in a season.[6]

Mating

Survival [edit]

The early days for fledged juveniles are more hazardous; during its first dives into water, about four days after leaving the nest, a fledgling may become waterlogged and drown.[5] Many young will not have learned to fish by the time they are driven out of their parents' territory, and only about half survive more than a week or two. Most kingfishers die of cold or lack of food, and a severe winter can kill a high percentage of the birds. Summer floods can destroy nests or make fishing difficult, resulting in starvation of the brood. Only a quarter of the young survive to breed the following year, but this is enough to maintain the population. Likewise, only a quarter of adult birds survive from one breeding season to the next. Very few birds live longer than one breeding season.[12] The oldest bird on record was 21 years.[13]

Other causes of death are cats, rats, collisions with vehicles and windows, and human disturbance of nesting birds, including riverbank works with heavy machinery. Since kingfishers are high up in the food chain, they are vulnerable to build-up of chemicals, and river pollution by industrial and agricultural products excludes the birds from many stretches of otherwise suitable rivers that would be habitats.[12]

This species was killed in Victorian times for stuffing and display in glass cases and for use in hat making. English naturalist William Yarrell also reported the country practice of killing a kingfisher and hanging it from a thread in the belief that it would swing to predict the direction in which the wind would blow.[14] Persecution by anglers and to provide feathers for fishing flies were common in earlier decades,[11] but are now largely a thing of the past.[12]

Feeding [edit]

Eating small fish

The Common Kingfisher hunts from a perch 1–2 m (3–6 ft) above the water, on a branch, post or riverbank, bill pointing down as it searches for prey. It bobs its head when food is detected to gauge the distance, and plunges steeply down to seize its prey usually no deeper than 25 cm (10 in) below the surface. The wings are opened under water and the open eyes are protected by the transparent third eyelid. The bird rises beak-first from the surface and flies back to its perch. At the perch the fish is adjusted until it is held near its tail and beaten against the perch several times. Once dead, the fish is positioned lengthways and swallowed head-first. A few times each day, a small greyish pellet of fish bones and other indigestible remains is regurgitated.[5]

The food is mainly fish up to 12.5 cm (4.9 in) long, but the average size is 2.3 cm (0.91 in). Minnows, sticklebacks, small roach and trout are typical prey. About 60% of food items are fish, but this kingfisher also catches aquatic insects such as dragonfly larvae and water beetles, and, in winter, crustaceans including freshwater shrimps.[5]

A challenge for any diving bird is the change in refraction between air and water. The eyes of many birds have two foveae (the fovea is the area of the retina the greatest density of light receptors),[15] and a kingfisher is able to switch from the main central fovea to the auxiliary fovea when it enters water; a retinal streak of high receptor density which connects the two foveae allows the image to swing temporally as the bird drops onto the prey.[16] The egg-shaped lens of the eye points towards the auxiliary fovea, enabling the bird to maintain visual acuity underwater.[15] Because of the positions of the foveae, the kingfisher has monocular vision in air, and binocular vision in water. The underwater vision is not as a sharp as in air, but the ability to judge the distance of moving prey is more important than the sharpness of the image.[16]

Each cone cell of a bird’s retina contains an oil droplet which may contain carotenoid pigments. These droplets enhance colour vision and reduce glare. Aquatic kingfishers have high numbers of red pigments in their oil droplets; the reason red droplets predominate is not understood, but the droplets may help with the glare or the dispersion of light from particulate matter in the water.[16]

Status [edit]

This species has a large range, with an estimated global extent of occurrence of 10 million square kilometres (3.8 million square miles). It has a large population, including an estimated 160,000–320,000 individuals in Europe alone. Global population trends have not been quantified, but populations appear to be stable so the species is not believed to approach the thresholds for the population decline criterion of the IUCN Red List (i.e., declining more than 30% in ten years or three generations). For these reasons, the species is evaluated as Least Concern.[1][3]

Notes [edit]

  1. ^ a b BirdLife International (2012). "Alcedo atthis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Linnaeus (1758):109. Note: What is now A. a. ispida is described on p. 115 as Alcedo ispida
  3. ^ a b c "Kingfisher Alcedo atthis (Linnaeus, 1758)". Bird facts. British Trust for Ornithology. Retrieved 21 August 2008. 
  4. ^ a b Fry, Fry & Harris (1999) 8–11
  5. ^ a b c d e f g h i j k l Fry, Fry & Harris (1999) 219–221
  6. ^ a b c d e Snow & Perrin (1998) 956–958
  7. ^ Parentheses indicate a new combination or change in status.
  8. ^ Arnold, Paula: Birds of Israel, (1962), Shalit Publishers Ltd., Haifa, Israel. p. 12
  9. ^ Peris, S. J.; Rodriguez, R. (1996). "Some factors related to distribution by breeding Kingfisher (Alcedo atthis L.)". Ekologia Polska 54 (1–2): 31–38. 
  10. ^ Lin, Wen-Loung; Tsai, Hsien-Hsiu; Wu Hsuan-Ju (2007). "Effect of ditch living thing by process of original structure replacement by RC irrigation ditch" (PDF). Journal of Chinese Soil and Water Conservation 38 (1): 31–42.  (Chinese)
  11. ^ a b c Coward (1930) 284–287
  12. ^ a b c "Survival and threats". Kingfisher. Royal Society for the Protection of Birds. Retrieved 23 August 2008. 
  13. ^ "Longevity list of birds ringed in Europe". Kingfisher. EURING. Retrieved 23 August 2008. 
  14. ^ Cocker (2005) 300
  15. ^ a b Sinclair (1985) 93–94
  16. ^ a b c Schwab, I. R.; Hart N. S. (May 2004). "Halcyon days". British Journal of Ophthalmology 88 (5): 613. doi:10.1136/bjo.2004.045492. PMC 1772125. PMID 15129670. 

References [edit]

  • Cocker, Mark; Mabey, Richard (2005). Birds Britannica. London: Chatto & Windus. ISBN 978-0-7011-6907-7. 
  • Coward, Thomas Alfred (1930). The Birds of the British Isles and Their Eggs (two volumes). Frederick Warne.  Third edition, volume 1.
  • Fry, C. Hilary; Fry, Kathie; Harris, Alan (1999). Kingfishers, Bee-eaters and Rollers. London: Christopher Helm. ISBN 978-0-7136-5206-2. 
  • Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii).  (Latin)
  • Sinclair, Sandra (1985). How Animals See: Other Visions of Our World. Beckenham, Kent: Croom Helm. ISBN 978-0-7099-3336-6. 
  • Snow, David; Perrins, Christopher M (editors) (1998). The Birds of the Western Palearctic (BWP) concise edition (2 volumes). Oxford: Oxford University Press. ISBN 978-0-19-854099-1. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!