Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Albatross are known to be amongst some of the longest-lived birds and the black-browed can continue to breed up to an age of 35 years (4). Adults become mature at seven years old and, having found a mate, will pair for life (4). The birds usually return to the same nesting site each September and a single egg is laid the following month. The incubation period lasts nearly two months and the chick stays on the nest until late March or early April (4). Black-browed albatross feed on fish, squid, octopus and crustaceans but will also take floating carrion if they find it (5). Albatrosses are also known as 'Mollymawks' across much of their range (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Albatrosses are one of the most marine of all birds, traversing the oceans of the southern hemisphere, and only returning to land to breed. They belong to the family of 'tube-noses', related to petrels, shearwaters and fulmars (2). The black-browed albatross is a large bird, although not amongst the largest members of their family, and are predominantly white beneath, with a dark border around the underwing. Above, the upperwing is dark grey and the bird appears as a black and white cross at a distance. The bill is yellow with a darker orange tip, and there is a dark eye-stripe, giving the birds their common English name. The sexes appear similar (4). Juvenile birds are similar to adults but have grey bills and a grey collar, as well as a dusky underwing (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The black-browed albatross is a bird of the southern oceans, and breeds on various islands throughout this extensive region. The principal islands are: the Falkland Islands, South Georgia and the South Sandwich Islands in the South Atlantic; the Indian Ocean islands of Crozet, Kerguelen and the Heard and McDonald Islands; the Southern Pacific islands of Islas Diego Ramirez, Ildefonso, Diego de Almagro and Isla Evangelistas off the coast of Chile; Macquarie Island (administered by Australia), and Campbell, Antipodes and Snares islands south of New Zealand (5). Black-brows also occur as a vagrant in the North Atlantic and individual birds have spent summer months on gannet colonies in Scottish waters (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

New Zealand Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Southern Hemisphere, Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Thalassarche melanophrys has a circumpolar distribution ranging from subtropical to polar waters43, breeding in the Falkland Islands (Islas Malvinas), Islas Diego Ramirez, Ildefonso, Diego de Almagro and Isla Evangelistas (Chile), South Georgia (Georgias del Sur), Crozet and Kerguelen Islands (French Southern Territories), Heard and McDonald Islands and Macquarie Island (Australia), and Campbell and Antipodes Islands, New Zealand1. Two breeding sites are also found in southern Chile on islets in Tierra del Fuego and in the Mallaganes region43. One colony was also recorded on Snares Island in 198643. The total breeding population was estimated at c.680,000 pairs in 1998, 80% at the Falkland Islands, 10% at South Georgia and 3% in Chile1. More recent data revised this to c.600,853 pairs, 67% in the Falkland Islands, 12% at South Georgia and 20% in Chile27,28,29. Populations at Bird Island (11% of the South Georgia total) declined by 4% per annum between 1989-1990 and 2003-200429, and the population on Kerguelen declined by 17% between 1978-1979 and 1994-199513. Numbers at Diego Ramirez may have decreased during the 1980s and recovered recently10,19. Numbers in the Falklands apparently increased substantially during the 1980s1,4, probably attributable to abundant offal and discards from trawl fisheries12. However, two full censuses of the Falkland Islands population has shown declines at most colonies, with a sharp decrease at Steeple Jason and Beauchêne islands (70% of the Falklands total)27. Currently the Falklands population is declining at 0.7% per annum27, though some colonies have increased in size; the trends are not consistent between years and sites, and even between sub-colonies within the sites. In addition, some colonies surveyed using aerial photography have reportedly shown increases between 21 and 141%41. The small population on Heard Island (c.600 pairs) appears to have increased over the past 50 years22. The combination of trends across colonies and, in particular, the declines in the Falklands, South Georgia and Kerguelen, indicate an overall decline of 67% over 64 years (three generations).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Black-browed albatross, Thalassarche melanophrys, can be found circumpolar in the southern hemisphere anywhere in the south Atlantic, but can travel further north with cold currents. Annually during the months of September and October, they breed on south Atlantic islands including the Falkland Islands and South Georgia, South Sandwich, and Cape Horn islands.

Biogeographic Regions: ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Mullay, M., Association. 1989. Seabirds an identification guide. London: Croom Helm LTD.
  • Tuck, G., H. Heinzel. 1978. A Field Guide to the Seabirds of Britain and the World. St. James's Place, London: HarperCollins.
  • del Hoyo, J., A. Elliot, J. Sargatal. 1992. Handbook of the birds of the world: ostrich to ducks. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Black-browed albatross are large birds ranging anywhere from 83 to 93 cm in length and weighing from 3 to 5 kg. They have broad, blunt wings with a wingspan of 240 cm. Their back is a dark grey which blends into blackish-grey scapulars. Their blackish-colored underwing is interrupted by a white central stripe that runs the length of the wing, though the prominence of the stripe is variable. They have a yellow bill with a pink tip that curves downward at the tip. Their head is white with a black line at the base of the bill and a black eyebrow encircling and tailing off behind the eye. The iris can range from a pale whitish color to amber. The birds display no sexual dimorphism.

Juvenile black-browed albatross have similar plumage to adults, however they have a ring of gray feathers around the nape of the neck. Juveniles also have some degree of black on their beaks.

Range mass: 3 to 5 kg.

Range length: 83 to 93 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This is a colonial, annually breeding species, although only 75% of successful breeders and 67% of failed breeders breed the following year. Individuals arrive at colonies in September, laying in early October with chicks hatching in December and fledging between April and May. Immature birds begin return to land at the age of two with the numbers of returning birds increasing up to the age of six. The median age of first breeding is 10 years (range 8-13)43. During incubation, breeding birds tend to remain in areas adjacent to or to the north of their colonies in the shelf, shelf-break and shelf-slope waters43. At Campbell Island, Black-browed Albatross show a unique bimodal foraging strategy, alternating between short trips to shelf areas around the breeding site and long trips to the Polar Front37. Birds foraging over the Benguela Current during the winter also showed a bimodal feeding strategy, alternating trips over deep, oceanic waters with trips over the continental shelf40. During incubation on the Falkland Islands, satellite tracking reveals males and females forage in different areas with almost no overlap38. After breeding, birds from the Falkland Islands (Islas Malvinas) winter on the Patagonian Shelf36, whereas birds from South Georgia predominantly migrate to South African waters, spending the first half of the winter in the highly productive Benguela Current32. Black-browed Albatross from Chile make use of the Chilean Shelf, the Patagonian Shelf, and some spend the non-breeding season around north New Zealand. Habitat Breeding The species nests colonially on steep slopes with tussock grass, sometimes on cliff terraces, but the largest colonies in the Falklands are on flat ground along the shore line. Diet It feeds mainly on crustaceans, fish and squid, and also on carrion and fishery discards33,34,35. The exact composition of its diet varies depending on locality and year43. Foraging Range During chick-rearing, breeding T. melanophrys initially stay in shelf to shelf-slope areas very close to their colonies (within c. 500 km). Later, birds from Chile and South Georgia (Islas Georgias del Sur) may also travel up to c. 3,000 km from their breeding sites, especially to the Antarctic Peninsula and South Orkney Islands, but birds from the Falkland Islands (Islas Malvinas) and Kerguelen continue to remain close to their colonies43.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black-browed albatross are marine, pelagic birds but commonly come inshore. It is typical for albatross to move toward shore during violent weather. They may travel thousands of kilometers off land in search of food. Their breeding grounds are often on steep slopes with tussock grass, cliff terraces, or level ground.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 29628 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24267 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.605 - 16.977
  Nitrate (umol/L): 1.697 - 28.640
  Salinity (PPS): 32.635 - 35.436
  Oxygen (ml/l): 5.500 - 8.188
  Phosphate (umol/l): 0.304 - 2.046
  Silicate (umol/l): 1.379 - 89.471

Graphical representation

Temperature range (°C): -1.605 - 16.977

Nitrate (umol/L): 1.697 - 28.640

Salinity (PPS): 32.635 - 35.436

Oxygen (ml/l): 5.500 - 8.188

Phosphate (umol/l): 0.304 - 2.046

Silicate (umol/l): 1.379 - 89.471
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

For much of the year, black-browed albatrosses are pelagic, spending months on end at sea (2). To breed, they choose islands having steeply sloping coasts with tussock grass, although they will nest on cliffs and on level shores (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Black-browed albatross mainly feed on crustaceans and fish but also squid and carrion (i.e. penguin corpses). A large portion of their diet consists of krill that they locate using a method known as local enhancement. This is when an albatross observes another albatross or foraging species successfully feeding and they come together to take advantage of the food source. They use their webbed feet to paddle themselves around and feed by surface-seizing or surface diving. They have often been known to follow trawlers looking for any discarded catch.

Animal Foods: fish; carrion ; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

  • Grunbaum, D., R. Veit. 2003. Black-browed albatrosses foraging on antarctic krill: density- dependence through local enhancement?. Ecology, Vol. 84 Issue 12: 3265-3275. Accessed March 18, 2010 at http://www.jstor.org.proxy.lib.fsu.edu/stable/3450070?&Search=yes&term=albatross&term=black browed&list=hide&searchUri=%2Faction%2FdoBasicSearch%3FQuery%3Dblack-browed%2Balbatross%26x%3D0%26y%3D0%26hp%3D25%26sorigin%3Dwww.ufv.ca%26cookieSet%3D1&item=2&ttl=263&returnArticleService=showArticle.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As the main dietary component, fish populations are likely impacted by black-browed albatross. Little is known regarding symbiotic relationships.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Black-browed albatross’ main threat is humans but they have also been known to be fed on by tiger sharks. Accidental death by long-line fishing methods poses the greatest threat to black-browed albatross. The recent population decline is believed to be caused by increases in local long-line fishing. In the past, mariners captured albatross for their meat and raided their colonies of nests for the eggs. Albatross eggs are often eaten by rats (Rattus) and chicks are preyed upon by skuas (Stercorarius).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Black-browed albatross are generally silent, but will make a rapid grunting noise within breeding colonies. They also make beak-clapping noises. Breeding pairs will communicate through several different courtship behaviors such as allopreening and beak touching. Like all birds, black-browed albatross perceive their environments through visual, auditory, tactile, and chemical stimuli.

Communication Channels: tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Black-browed albatross in captivity have a maximum lifespan of 32.5 years. In the wild they generally live around 30 or more years but have been known to live as long as 70 years.

Range lifespan

Status: wild:
70 (high) years.

Range lifespan

Status: captivity:
35.2 (high) years.

Average lifespan

Status: wild:
30 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 43.7 years (wild) Observations: In the wild, these animals can live up to 43.7 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Black-browed albatross are monogamous and often mate for life. Pairs often engage in mutualistic feeding rituals. Black-browed albatross often engage in beak touching and allopreening between mates. In general, albatross are well-known for elaborate courtship behaviors.

Mating System: monogamous

Black-browed albatross breed from September or October to April. They are colonial during the breeding season and make their nests out of mud, grass, guano, and seaweed. They build nests that are on a volcano-shaped dome where they incubate a single egg for 71 days. The chicks are born with grayish white down and are brooded for one to four weeks. Chicks fledge after 120 days and they reach sexual maturity after 7 to 9 years.

Breeding interval: Black-browed Albatrosses breed annually.

Breeding season: Black-browed albatrosses breed from September to April.

Average eggs per season: 1.

Average time to hatching: 71 days.

Average fledging age: 120 days.

Range age at sexual or reproductive maturity (female): 7 to 9 years.

Range age at sexual or reproductive maturity (male): 7 to 9 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both parents participate in egg incubation which can last up to 71 days. Chicks are born precocial, with downy feathers and eyes open. Both parents feed the young. Parents tend the hatchling for several months, then abandon the chick before it fledges.

Parental Investment: precocial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female)

  • Falklands Conservation, 2010. "Black-browed albatross" (On-line). Accessed March 19, 2010 at http://www.falklandsconservation.com/wildlife/albatross/black-browed-albatross.html.
  • National Audubon Society, , L. Line, F. Russell. 1976. The audubon society book of wild birds. New York: Harry N. Abrams Incorporated.
  • del Hoyo, J., A. Elliot, J. Sargatal. 1992. Handbook of the birds of the world: ostrich to ducks. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassarche melanophrys

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTGACCTTCATTAACCGATGACTGTTTTCAACCAACCATAAAGATATCGGCACACTATACTTAATTTTTGGTGCATGAGCCGGCATAGTCGGAACCGCACTCAGCTTACTTATCCGTGCAGAACTTGGTCAGCCAGGAACCCTCCTGGGAGACGACCAAATCTACAATGTAATCGTCACCGCTCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGAAACTGACTAGTACCACTTATAATTGGTGCACCTGACATAGCATTTCCACGTATAAATAATATAAGCTTTTGATTACTACCCCCATCCTTCCTCCTCCTACTAGCATCCTCCACAGTAGAAGCAGGAGCAGGTACAGGATGAACTGTGTACCCGCCTCTAGCTGGCAACCTTGCCCACGCAGGGGCTTCAGTAGACCTGGCTATCTTCTCCCTCCACCTAGCAGGTGTTTCATCAATCCTAGGAGCAATTAACTTCATCACAACTGCCATCAATATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTACTCATTACTGCCGTCTTACTCTTACTTTCACTACCAGTCCTTGCCGCCGGTATTACCATACTACTAACAGATCGAAACCTAAATACTACATTCTTCGACCCAGCTGGAGGAGGGGACCCAGTCCTATATCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTCTACATTTTAATTTTACCTGGCTTTGGAATCATCTCGCATGTAGTAACATACTACGCAGGTAAAAAAGAACCGTTCGGCTACATAGGAATAGTATGAGCCATACTCTCCATTGGATTCCTAGGCTTCATCGTATGGGCCCACCATATATTTACAGTAGGAATAGACGTAGACACTCGAGCATACTTCACATCTGCCACTATAATCATTGCCATTCCCACTGGAATCAAAGTCTTCAGCTGGTTAGCCACCCTACACGGAGGAGCCATTAAATGAGATCCACCCATACTATGGGCCCTAGGGTTTATCTTCCTCTTCACCATCGGAGGACTTACAGGTATCGTCCTGGCAAATTCCTCACTAGATATTGCCCTTCATGACACATACTATGTAGTTGCTCACTTCCACTATGTCCTCTCAATAGGGGCTGTCTTCGCTATCCTAGCAGGATTCACCCACTGATTCCCGCTATTCACAGGGTACACCCTACACCCTACATGAGCTAAAGCCCACTTCGGAGTTATATTTACAGGCGTAAACCTAACCTTCTTCCCACAACACTTCCTAGGCTTAGCCGGTATACCACGACGATACTCCGATTACCCAGATGCTTACACCCTATGAAACACCATATCCTCCATCGGCTCACTAATCTCAATAACCGCCGTAATTATACTAATATTCATTATCTGAGAAGCCTTTGTATCAAAACGAAAAGTCCTACAACCAGAACTAATCTCCACTAACATTGAATGAATCCACGGCTGCCCACCCCCATATCACACCTTCGAAGAGCCAGCCTTCGTTCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thalassarche melanophrys

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thalassarche melanophris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4bd

Version
3.1

Year Assessed
2010

Assessor/s
BirdLife International

Reviewer/s
Calvert, R., Butchart, S., Bird, J.

Contributor/s
Huin, N., Robertson, G., Croxall, J., Phillips, R., Arata, J.

Justification
This species is listed as Endangered because it is estimated to be declining at a very rapid rate over three generations (65 years) on the basis of current rates of decline at the large breeding colonies in the south-west Atlantic. These declines have been attributed to the impact of incidental mortality in longline and trawl fisheries.

History
  • 2008
    Endangered
  • 2005
    Endangered
  • 2004
    Endangered
  • 2003
    Endangered
  • 2002
    Vulnerable
  • 1994
    Not Recognized
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black-browed albatross are currently listed as endangered by the IUCN Red List. The rationalization for their conservation status is the rapid decline in their populations. This decline is due to deaths attributed to long-line and trawl fisheries (net and line entanglement), disruption in prey populations, plastic ingestion, natural disasters (floods, fires, & volcanic activity), habitat destruction, pollution, and disease .

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List of 2007 (1). Listed under Appendix II of the Convention on Migratory Species (CMS or Bonn Convention) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total population of 600,852 breeding pairs (equating to 1,220,000 mature individuals) is made up of 399,416 pairs in the Falkland Islands (Islas Malvinas) (Huin and Reid 2007), 74,296 pairs in South Georgia (Poncet et al. 2006) 122,000 pairs in Chile (Robertson et al. 2007) and other populations (Antipodes, Campbell, Heard and MacDonald, Crozet, Kerguelen, Macquarie, Snares) (Gales 1998).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Declines may be attributable to increased longline fishing effort and/or the development of new longline fisheries over much of the Patagonian Shelf, around South Georgia, off the southern African coast, and in the Southern Ocean8,9,11,15. Indeed, it is one of the most frequently killed species in many longline fisheries including tuna longliners off southern Africa, the pelagic longline swordfish fishery off Chile and Argentine longlingers targetting toothfish and kingclip on the Patagonian shel5,9,11,16,17,18,23,39. Capture rates can vary greatly according to season, number of hooks and type of longline39. Over recent years, mortality in trawl fisheries has been identified as a major source of mortality for this species over the Patagonian Shelf20 and South Africa30, with an estimated minimum 5,000 killed per annum across the deep-water hake trawl fishery in south African waters during winter42. Recent large-scale volcanic eruptions at Heard Island (2003-2004 in particular) may have caused most birds to desert nesting sites43. The explosion in European rabbit Oryctolagus cuniculus numbers on Macquarie Island since 1999 has led to an extensive destruction of habitat and soil erosion at nesting sites. An eradication programme which will also target rodents is planned to commence in 2010. Cats (Felis catus) are thought to impact upon colonies on the Kerguelen Islands at Jeanne d'Arc Peninsula.43
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The greatest threat to this species is thought to be the increase in by-catch as a result of long-line sea fishing in the southern oceans, especially along the Patagonian shelf off the east coast of Argentina and Uruguay (5). An estimated 60 percent of the total breeding population of around 530, 000 individuals breed on the Falkland Islands and another 20 percent on South Georgia (5). The Falklands population has declined by almost a third during the last two decades, most of this within a period of five years to 2001 (5). Much of this decline is blamed on an increase in long-line fishing in the surrounding seas, but the black-browed albatross is at risk from this practice throughout its range. It is one of the most frequent victims of both long-line and trawler fishing in the southern hemisphere (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CMS Appendix II and ACAP Annex 1. It is monitored at South Georgia, Kerguelen, Campbell, Diego Ramirez and the Falkland Islands. Most breeding sites are reserves. Heard and McDonald, Macquarie, and the New Zealand islands are World Heritage Sites. An initial census of Chilean islands has been completed21.

Conservation Actions Proposed
Continue monitoring and research programmes at all sites. Conduct complete censuses at all sites at regular intervals (South Georgia, Chile, Falkland Islands [Islas Malvinas] and French Southern Territories). Assess the impact of trawl fisheries bycatch . Continue to develop mitigation strategies for trawl fisheries, notably on the Patagonian Shelf and South Africa. Promote adoption of a) monitoring of seabirds bycatch associated with longline fishing and b) best-practice mitigation measures in all fisheries within the species's range, including via intergovernmental mechanisms under the auspices of ACAP, FAO and Regional Fisheries Management Organisations such as CCAMLR and the tuna commissions of the Atlantic Ocean (ICCAT).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

As a result of fears over its declining population, the IUCN has upgraded the status of the black-browed albatross to 'Endangered' (1). On the basis of the losses at the birds' chief breeding sites, it is calculated that it will have declined by around 65 percent during the next 65 years and by more than 50 percent throughout the rest of its range over the same period (5). Monitoring of the birds' breeding continues, and the fleets of those countries that regularly fish these waters are being encouraged to monitor bird by-catch and pursue safer fishing methods to minimise accidental netting of this species (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of black-browed albatross on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive effects of black-browed albatross on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black-browed Albatross

Sub-adult plumage

The Black-browed Albatross (Thalassarche melanophrys), also known as the Black-browed Mollymawk,[3] is a large seabird of the albatross family Diomedeidae; it is the most widespread and common member of its family.

Contents

Taxonomy

Mollymawks are albatrosses in the Diomedeidae family and Procellariiformes order, which also includes shearwaters, fulmars, storm petrels, and diving petrels. These birds share certain identifying features. They have nasal passages that attach to the upper bill called naricorns, although the nostrils on the albatross are on the sides of the bill. The bills of Procellariiformes are also unique in that they are split into between seven and nine horny plates. They produce a stomach oil made up of wax esters and triglycerides that is stored in the proventriculus. This is used against predators as well as being an energy-rich food source for chicks and also for the adults during their long flights.[4] The albatross also has a salt gland above the nasal passage which helps to remove salt from the ocean water that they imbibe. The gland excretes a high saline solution through the bird's nose.[5]

In 1998, Robertson & Nunn published their view that the Campbell Albatross, Thalassarche melanophrys, should be split from this species.[6] Over the course of the next few years, other agreed, including BirdLife International in 2000,[7] and Brooke in 2004.[8] James Clements has not adopted the split yet,[9] neither has ACAP, and the SACC recognizes the need for a proposal.[10]

The Black-browed Albatross was first described as Diomedea melanophris by Coenraad Jacob Temminck, in 1828, based on a specimen from Cape of Good Hope.[11]

Etymology

The origin of the name melanophrus comes from two Greek words melas or melanos, meaning "black", and ophrus, meaning "eyebrow", referring to dark feathering around the eyes.[12]

Description

East of Tasmania, Southern Ocean

The Black-browed Albatross is a medium-sized albatross, at 80–95 cm (31–37 in) long with a 200–240 cm (79–94 in) wingspan and an average weight of 2.9–4.7 kg (6.4–10 lb).[3] It can have a natural lifespan of over 70 years. It has a dark grey saddle and upperwings that contrast with the white rump, and underparts. The underwing is predominantly white with broad, irregular, black margins. It has a dark eyebrow and a yellow-orange bill with a darker reddish-orange tip. Juveniles have dark horn-colored bills with dark tips, and a grey head and collar. They also have dark underwings. The features that distinguish it from other mollymawks (except the closely related Campbell Albatross) are the dark eyestripe which gives it its name, a broad black edging to the white underside of its wings, white head and orange bill, tipped darker orange. The Campbell Albatross is very similar but with a pale eye. Immature birds are similar to Grey-headed Albatrosses but the latter have wholly dark bills and more complete dark head markings.

Range and habitat

Breeding Population and Trends[7]
LocationPopulationDateTrend
Falkland Islands399,416 pairs2007Decreasing 0.7% yr
South Georgia Island74,296 pairs2006Decreasing
Chile122,000 pairs2007
Antipodes Island ?1998
Campbell Island ?1998
Heard Island600 pairs1998Increasing
McDonald Island ?1998
Crozet Islands ?1998
Kerguelen Islands ?1998Decreasing
Macquarie Island ?1998
Snares Islands ?1998
Total150,000 pairs2005Decreasing

The Black-browed Albatross is circumpolar in the southern oceans, and it breeds on 12 islands throughout the southern oceans. In the Atlantic Ocean, it breeds on the Falklands, Islas Diego Ramírez, and South Georgia. In the Pacific Ocean it breeds on Islas Ildefonso, Diego De Almagro, Islas Evangelistas, Campbell Island, Antipodes Islands, Snares Islands, and Macquarie Island. Finally in the Indian Ocean it breeds on the Crozet Islands, Kerguelen Islands, Heard Island, and McDonald Island.[13] There are an estimated 1,220,000 birds alive with 600,853 breeding pairs, as estimated by a 2005 count. Of these birds, 402,571 breed in the Falklands, 72,102 breed on South Georgia Island, 120,171 breed on the Chilean islands of Islas Ildefonso, Diego De Almagro, Islas Evangelistas, and Islas Diego Ramírez. 600 pairs breed on Heard Island, Finally, the remaining 5,409 pairs breed on the remaining islands.[11][14][15] This particular species of albatross prefers to forage over shelf and shelf-break areas. Falkland Island birds winter near the Patagonian Shelf, and birds from South Georgia forage in South African waters, using the Benguela Current, and the Chilean birds forage over the Patagonian Shelf, the Chilean Shelf, and even make it as far as New Zealand. It is the most likely albatross to be found in the North Atlantic due to a northerly migratory tendency. There have been 20 possible sightings in the Continental United States.[16]

Behaviour

Associating with a killer whale. Picture taken by an albatross-borne camera.
Taking off

Colonies are very noisy as they bray to mark their territory, and also cackle harshly. They use their fanned tail in courting displays.[3]

Feeding

The Black-browed Albatross feeds on fish, squid, crustaceans, carrion, and fishery discards.[17][18][19] This species has been observed stealing food from other species.[3]

Reproduction

Egg - MHNT
Colony on Saunders Island, Falkland Islands

This species normally nests on steep slopes covered with tussock grass and sometimes on cliffs; however, on the Falklands it nests on flat grassland on the coast.[7] They are an annual breeder laying one egg from between 20 September and 1 November, although the Falklands, Crozet, and Kerguelen breeders lay about three weeks earlier. Incubation is done by both sexes and lasts 68 to 71 days. After hatching, the chicks take 120 to 130 days to fledge. Juveniles will return to the colony after two to three years but only to practice courtship rituals, as they start breeding around the 10th year.[3]

Conservation

the IUCN classifies this species as Endangered due to drastic reduction in population. Bird Island near South Georgia Island had a 4% per year loss of nesting pairs,[15] and the Kerguelen Island population had a 17% reduction from 1979 to 1995.[20] Diego Ramírez decreased in the 1980s but has rebounded recently,[21][22] and the Falklands had a surge in the 1980s[13][23] probably due to abundant fish waste from trawlers;[24] however, recent censuses have shown drastic reduction in the majority of the nesting sites there.[14] Between all the ups and downs, the overall situation is grim, with a 67% decline over 64 years.[7]

Increased longline fishing in the southern oceans, especially around the Patagonian Shelf and around South Georgia has been attributed as a major cause of the decline of this bird,[25][26][27][28] In fact, the Black-browed Albatross is the most common bird killed by fisheries.[26][27][29][30][31][32][33] Not to be left out trawl fishing, especially around the Patagonian Shelf[34] and near South Africa, is also a large reason.[35]

Conservation efforts underway start with this species being placed on Convention on Migratory Species Appendix II, and Agreement on the Conservation of Albatrosses and Petrels Annex 1, it is being monitored on half of the islands, and most of the breeding sites are reserves. Heard Island, McDonald Island, Macquarie Island, and the New Zealand islands are World Heritage Sites. Finally, an initial Chilean census has been completed.[36]

Noteworthy

Although this is a rare occurrence, on several occasions a Black-browed Albatross has summered in Scottish Gannet colonies (Bass Rock, Hermaness and now Sula Sgeir) for a number of years. Ornithologists believe that it was the same bird, known as Albert, who lives in north Scotland.[37][38] It is believed that the bird was blown off course into the North Atlantic over 40 years ago, and it is suspected that the bird is over 47 years old. A similar incident took place in the gannet colony in the Faroe Islands island of Mykines, where a Black-browed Albatross lived among the gannets for over 30 years. This incident is the reason why an albatross is referred to as a 'Gannet King' (Faroese: súlukongur) in Faroese.[39]

Footnotes

  1. ^ BirdLife International (2008)
  2. ^ Brands, S. (2008)
  3. ^ a b c d e Robertson, C. J. R. (2003)
  4. ^ Double, M. C. (2003)
  5. ^ Ehrlich, Paul R. (1988)
  6. ^ Robertson, C. J. R. & Nunn (1998)
  7. ^ a b c d BirdLife International (2008)(a)
  8. ^ Brooke, M. (2004)
  9. ^ Clements, J. (2007)
  10. ^ Remsen Jr., J. V. (2008)
  11. ^ a b Robertson, G.; et al. (2007)
  12. ^ Gotch, A. F. (1995)
  13. ^ a b Croxall, J. P. & Gales, R. (1998)
  14. ^ a b Huin, N. & Reid, T. (2007)
  15. ^ a b Poncet, S.; et al. (2006)
  16. ^ Dunn, Jon L. & Alderfer, Jonathan (2006)
  17. ^ Cherel, Y.; et al. (2002)
  18. ^ Xavier, J. C.; et al. (2003)
  19. ^ Arata, J.; et al. (2003)
  20. ^ Weimerskirch, H. & Jouventin, P. (1998)
  21. ^ Schlatter, R. P. (1984)
  22. ^ Arata, J. & Moreno, C. A. (2002)
  23. ^ Gales, R. (1998)
  24. ^ Thompson, K. R. & Riddy, M. D. (1995)
  25. ^ Prince, P. A.; et al. (1998)
  26. ^ a b Schiavini, A.; et al. (1998)
  27. ^ a b Stagi, A.; et al. (1998)
  28. ^ Tuck, G. & Polacheck, T. (1997)
  29. ^ Gales, R.; et al. (1998)
  30. ^ Murray, T. E.; et al. (1993)
  31. ^ Ryan, P. G. & Boix-Hinzen, C. (1998)
  32. ^ Ryan, P. G.; et al. (2002)
  33. ^ Reid, T. A. & Sullivan, B. J. (2004)
  34. ^ Sullivan, B. J. & Reid, T. A. (2002)
  35. ^ Watkins, B. P.; et, al (2007)
  36. ^ Lawton, K.; et al. (2004)
  37. ^ Ivens, Martin (9 May 2007)
  38. ^ "No romance for lovesick albatross". BBC. 9 May 2007. Retrieved 9 May 2007. 
  39. ^ á Ryggi, M. (1951)

References

  • BirdLife International (2008). Thalassarche melanophrys. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 22 Feb 2009.
  • Alsop, III, Fred J. Smithsonian Birds of North America. Dorling Kindersley ISBN 0-7894-8001-8
  • Arata, J.; Moreno, C. A. (2002). "Progress report of Chilean research on albatross ecology and conservation". Convention for the Conservation of Antarctic Marine Living Resources Working Group on Fish Stock Assessment. 
  • Arata, J.; Robertson, G.; Valencia, J.; Lawton, K (2003). "The Evangelistas Islets, Chile: a new breeding site for black-browed albatrosses". Polar Biology (26): 687–690. 
  • BirdLife International (2008(a)). "Black-browed Albatross – BirdLife Species Factsheet". Data Zone. Retrieved 22 February 2009. 
  • Brands, Sheila (14 August 2008). "Systema Naturae 2000 / Classification – Diomedea subg. Thalassarche –". Project: The Taxonomicon. Retrieved 22 February 2009. 
  • Brooke, M. (2004). "Procellariidae". Albatrosses And Petrels Across The World. Oxford, UK: Oxford University Press. ISBN 0-19-850125-0. 
  • Cherel, Y.; Weimerskirch, H.; Trouve, C. (2002). "Dietary evidence for spatial foraging segregation in sympatric albatrosses (Diomedea spp.) rearing chicks at Iles Nuageuses, Kerguelen". Marine Biology (141): 1117–1129. 
  • Clements, James (2007). The Clements Checklist of the Birds of the World (6 ed.). Ithaca, NY: Cornell University Press. ISBN 978-0-8014-4501-9. 
  • Croxall, J. P.; Gales, R. (1998). "Assessment of the conservation status of albatrosses". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons. 
  • Double, M. C. (2003). "Procellariiformes (Tubenosed Seabirds)". In Hutchins, Michael; Jackson, Jerome A.; Bock, Walter J. et al. Grzimek's Animal Life Encyclopedia. 8 Birds I Tinamous and Ratites to Hoatzins. Joseph E. Trumpey, Chief Scientific Illustrator (2 ed.). Farmington Hills, MI: Gale Group. pp. 107–111. ISBN 0-7876-5784-0. 
  • Dunn, Jon L.; Alderfer, Jonathan (2006). "Albatrosses". In Levitt, Barbara. National Geographic Field Guide to the Birds of North America (fifth ed.). Washington D.C.: National Geographic Society. p. 80. ISBN 978-0-7922-5314-3. 
  • Ehrlich, Paul R.; Dobkin, David, S.; Wheye, Darryl (1988). The Birders Handbook (First ed.). New York, NY: Simon & Schuster. pp. 29–31. ISBN 0-671-65989-8. 
  • Gales, R. (1998). "Albatross populations: status and threats". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons 
  • Gales, R.; Brothers, N.; Reid, T. (1998). "Seabird mortality in the Japanese tuna longline fishery around Australia, 1988–1995". Biological Conservation (86): 37–56. 
  • Gotch, A. F. (1995) [1979]. "Albatrosses, Fulmars, Shearwaters, and Petrels". Latin Names Explained A Guide to the Scientific Classifications of Reptiles, Birds & Mammals. New York, NY: Facts on File. p. 191. ISBN 0-8160-3377-3. 
  • Huin, N.; Reid, T. (April 2007). "Census of the Black-browed Albatross population of the Falkland Islands, 2000 and 2005" (PDF). Falklands Conservation. Retrieved 23 February 2009. 
  • Ivens, Martin (9 May 2007). "The lonely albatross looking for love in all the wrong places". London: Lewis Smith, The Times. Retrieved 10 May 2007. 
  • Lawton, K.; Robertson, G.; Valencia, J.; Wienecke, B.; Kirkwood, R. (2003). "The status of Black-browed Albatrosses Thalassarche melanophrys at Diego de Almagro Island, Chile". Ibis (145): 502–505. 
  • Murray, T. E.; Bartle, J. A.; Kalish, S. R.; Taylor, P. R. (1993). "Incidental capture of seabirds by Japenese southern bluefin tuna longline vessels in New Zealand waters, 1988–1992". Bird conservationalist internationalbird conservationalist international (3): 181–210. 
  • Poncet, S.; Robertson, G.; Phillips, R. A.; Lawton, K.; Phalan, B.; Trathan, P. N.; Croxall, J. P. (2006). "Status and distribution of wandering Black-browed and Grey-headed Albatrosses breeding at South Georgia". Polar Biology (29): 772–781. 
  • Prince, P. A.; Croxall, J. P.; Trathan, P. N.; Wood, A. G. (1998). "The pelagic distribution of South Georgia albatrosses and their relationships with fisheries". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons 
  • Reid, T. A.; Sullivan, B. J. (2004). "Longliners, black-browed albatross mortality and bait scavenging in Falkland Island waters: what is the relationship?". Polar Biology (27): 131–139. 
  • Remsen Jr., J. V.; et al. (7 August 2008). "A classification of the bird species of South America, South American Classification Committee, American Ornithologists' Union". South American Classification Committee. American Ornithologists' Union. Retrieved 22 February 2009. 
  • Robertson, C. J. R. (2003). "Albatrosses (Diomedeidae)". In Hutchins, Michael; Jackson, Jerome A.; Bock, Walter J. et al. Grzimek's Animal Life Encyclopedia. 8 Birds I Tinamous and Ratites to Hoatzins. Joseph E. Trumpey, Chief Scientific Illustrator (2 ed.). Farmington Hills, MI: Gale Group. p. 120. ISBN 0-7876-5784-0. 
  • Robertson, G.; Moreno, C. A.; Lawton, K.; Arata, J.; Valencia, J.; Kirkwood, R. (2007). "An estimate of the population sizes of Black-browed (Thalassarche melanophrys) and Grey-headed (T. chrysostoma) Albatross breeding in the Diego Ramírez Archipelago, Chile". Emu (107): 239–244. 
  • Robertson, C. J. R.; Nunn, G. B. (1998). "Towards a new taxonomy for albatrosses". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons. pp. 13–19. 
  • Ryan, P.G.; Boix-Hinzen, C. (1998). "Tuna long-line fisheries off southern Africa: the need to limit seabird bycatch". South African Journal of Science (94): 179–182. 
  • Ryan, P. G.; Keith, D. G.; Kroese, M. (2002). "Seabird bycatch by tuna longline fisheries off southern Africa, 1998–2000". South African Journal of Science (24): 103. 
  • Schiavini, A.; Frere, E.; Gandini, P.; Garcia, N.; Crespo, E. (1998). "Albatross-fisheries interactions in Patagonian shelf waters". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons. pp. 208–213. 
  • Schlatter, R. P. (1984). "The status and conservation of seabirds in Chile". In Croxall, J. P.; Evans, P. G. H.; Schreiber, R. W. Status and conservation of the world's seabirds. Cambridge, U.K.: International Council for Bird Preservation (Techn. Publ.). pp. 261–269. 
  • Stagi, A.; Vaz-Ferreira, R.; Marin, Y.; Joseph, L. (1998). "The conservation of albatrosses in Uruguayan waters". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty & Sons. pp. 220–224. 
  • Sullivan, B.; Reid, T. (2002). "Seabird interactions/mortality with longliners and trawlers in the Falkland/Malvinas Island waters". Unpublished report. CCAMLR-WG-FSA-02/36. 
  • Thompson, K. R.; Riddy, M. D. (1995). "Utilisation of offal discards from finfish trawlers around the Falkland Islands by the Black-browed Albatross Diomedea melanophris". Ibis (137): 198–206. 
  • Tuck, G.; Polacheck, T. (1997). Trends in tuna long-line fisheries in the Southern Oceans and implications for seabird by-catch: 1997 update (CCSBT–ERS/97). Hobart, Australia: Division of Marine Research. 
  • Watkins, B. P.; Petersen, S. L.; Ryan, P. G. (2007). "Interactions between seabirds and deep-water hake trawl gear: an assessment of impacts in South African waters". Biological Conservation (DRAFT). 
  • Weimerskirch, H.; Jouventin, P. (1998). "Changes in population sizes and demographic parameters of six albatross species breeding on the French sub-antarctic islands". In Robertson, G.; Gales, R. Albatross biology and conservation. Chipping Norton, Australia: Surrey Beatty and Sons. pp. 84–91 
  • Xavier, J. C.; Croxall, J. P.; Trathan, P. N.; Wood, A. G. (2003). "Feeding strategies and diets of breeding grey-headed and wandering albatrosses at South Georgia". Marine Biology (143): 221–232. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!