Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Albatross are known to be amongst some of the longest-lived birds and the black-browed can continue to breed up to an age of 35 years (4). Adults become mature at seven years old and, having found a mate, will pair for life (4). The birds usually return to the same nesting site each September and a single egg is laid the following month. The incubation period lasts nearly two months and the chick stays on the nest until late March or early April (4). Black-browed albatross feed on fish, squid, octopus and crustaceans but will also take floating carrion if they find it (5). Albatrosses are also known as 'Mollymawks' across much of their range (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Albatrosses are one of the most marine of all birds, traversing the oceans of the southern hemisphere, and only returning to land to breed. They belong to the family of 'tube-noses', related to petrels, shearwaters and fulmars (2). The black-browed albatross is a large bird, although not amongst the largest members of their family, and are predominantly white beneath, with a dark border around the underwing. Above, the upperwing is dark grey and the bird appears as a black and white cross at a distance. The bill is yellow with a darker orange tip, and there is a dark eye-stripe, giving the birds their common English name. The sexes appear similar (4). Juvenile birds are similar to adults but have grey bills and a grey collar, as well as a dusky underwing (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

The black-browed albatross is a bird of the southern oceans, and breeds on various islands throughout this extensive region. The principal islands are: the Falkland Islands, South Georgia and the South Sandwich Islands in the South Atlantic; the Indian Ocean islands of Crozet, Kerguelen and the Heard and McDonald Islands; the Southern Pacific islands of Islas Diego Ramirez, Ildefonso, Diego de Almagro and Isla Evangelistas off the coast of Chile; Macquarie Island (administered by Australia), and Campbell, Antipodes and Snares islands south of New Zealand (5). Black-brows also occur as a vagrant in the North Atlantic and individual birds have spent summer months on gannet colonies in Scottish waters (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

Thalassarche melanophris has a circumpolar distribution ranging from subtropical to polar waters (ACAP 2009), breeding in the Falkland Islands (Islas Malvinas), Islas Diego Ramirez, Ildefonso, Diego de Almagro and Isla Evangelistas (Chile), South Georgia (Georgias del Sur), Crozet and Kerguelen Islands (French Southern Territories), Heard and McDonald Islands and Macquarie Island (Australia), and Campbell and Antipodes Islands, New Zealand (Croxall and Gales 1998). Two breeding sites are also found in southern Chile on islets in Tierra del Fuego and in the Mallaganes region (ACAP 2009). One colony was also recorded on Snares Island in 1986 (ACAP 2009). The total breeding population was estimated at c.700,000 pairs in 2010, c.72% at the Falkland Islands (Islas Malvinas), 19% in Chile and 8% at South Georgia (ACAP unpubl. data). Numbers in the Falklands apparently increased substantially during the 1980s, and were thought to have since declined, however aerial and ground-based surveys conducted in 2010 revealed an increase of at least 4% per annum between 2005 and 2010 (Wolfaardt 2012). The small population on Heard Island (c.600 pairs) appears to have increased over the past 50 years. Trends are still uncertain for the populations in Chile. Adult survival on South Georgia decreased from 93% pre-1970 to 89% in 1987, and breeding success also decreased over the same period from 36% to 18% (Croxall 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black-browed albatross, Thalassarche melanophrys, can be found circumpolar in the southern hemisphere anywhere in the south Atlantic, but can travel further north with cold currents. Annually during the months of September and October, they breed on south Atlantic islands including the Falkland Islands and South Georgia, South Sandwich, and Cape Horn islands.

Biogeographic Regions: ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Mullay, M., Association. 1989. Seabirds an identification guide. London: Croom Helm LTD.
  • Tuck, G., H. Heinzel. 1978. A Field Guide to the Seabirds of Britain and the World. St. James's Place, London: HarperCollins.
  • del Hoyo, J., A. Elliot, J. Sargatal. 1992. Handbook of the birds of the world: ostrich to ducks. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Black-browed albatross are large birds ranging anywhere from 83 to 93 cm in length and weighing from 3 to 5 kg. They have broad, blunt wings with a wingspan of 240 cm. Their back is a dark grey which blends into blackish-grey scapulars. Their blackish-colored underwing is interrupted by a white central stripe that runs the length of the wing, though the prominence of the stripe is variable. They have a yellow bill with a pink tip that curves downward at the tip. Their head is white with a black line at the base of the bill and a black eyebrow encircling and tailing off behind the eye. The iris can range from a pale whitish color to amber. The birds display no sexual dimorphism.

Juvenile black-browed albatross have similar plumage to adults, however they have a ring of gray feathers around the nape of the neck. Juveniles also have some degree of black on their beaks.

Range mass: 3 to 5 kg.

Range length: 83 to 93 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This is a colonial, annually breeding species, although only 75% of successful breeders and 67% of failed breeders breed the following year. Individuals arrive at colonies in September, laying in early October with chicks hatching in December and fledging between April and May. Immature birds begin to return to land at the age of two with the numbers of returning birds increasing up to the age of six. The median age of first breeding is 10 years (range 8-13) (ACAP 2009). During incubation, breeding birds tend to remain in areas adjacent to or to the north of their colonies in the shelf, shelf-break and shelf-slope waters (ACAP 2009). At Campbell Island, Black-browed Albatross show a unique bimodal foraging strategy, alternating between short trips to shelf areas around the breeding site and long trips to the Polar Front (Waugh et al. 1999). Birds foraging over the Benguela Current during the winter also showed a bimodal feeding strategy, alternating trips over deep, oceanic waters with trips over the continental shelf (Petersen et al. 2008). During incubation on South Georgia, satellite tracking reveals males and females forage in different areas with almost no overlap (Phillips et al. 2004). After breeding, birds from the Falkland Islands (Islas Malvinas) winter on the Patagonian Shelf (N. Huin in litt 2008), whereas birds from South Georgia predominantly migrate to South African waters, spending the first half of the winter in the highly productive Benguela Current (Phillips et al. 2005). Black-browed Albatross from Chile make use of the Chilean Shelf, the Patagonian Shelf, and some spend the non-breeding season around north New Zealand. Habitat Breeding The species nests colonially on steep slopes with tussock grass, sometimes on cliff terraces, but the largest colonies in the Falklands are on flat ground along the shore line. Diet It feeds mainly on crustaceans, fish and squid, and also on carrion and fishery discards (Cherel et al. 2002, Arata et al. 2003, Xavier et al. 2003). A Wilsons Storm-petrel was recorded in the stomach contents of a bycaught individual on the Patagonian Shelf (Seco Pon and Gandini 2008), and while various Sphenisciformes and Procellariiformes have been found in the stomachs of albatrosses, penguins tend to be recorded more frequently, although none are typical prey items (Seco Pon and Gandini 2008). The exact composition of its diet varies depending on locality and year (ACAP 2009). Foraging Range During chick-rearing, breeding T. melanophrys initially stay in shelf to shelf-slope areas very close to their colonies (within c. 500 km). Later, birds from Chile and South Georgia (Islas Georgias del Sur) may also travel up to c. 3,000 km from their breeding sites, especially to the Antarctic Peninsula and South Orkney Islands, but birds from the Falkland Islands (Islas Malvinas) and Kerguelen continue to remain close to their colonies (ACAP 2009).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 29628 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24267 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.605 - 16.977
  Nitrate (umol/L): 1.697 - 28.640
  Salinity (PPS): 32.635 - 35.436
  Oxygen (ml/l): 5.500 - 8.188
  Phosphate (umol/l): 0.304 - 2.046
  Silicate (umol/l): 1.379 - 89.471

Graphical representation

Temperature range (°C): -1.605 - 16.977

Nitrate (umol/L): 1.697 - 28.640

Salinity (PPS): 32.635 - 35.436

Oxygen (ml/l): 5.500 - 8.188

Phosphate (umol/l): 0.304 - 2.046

Silicate (umol/l): 1.379 - 89.471
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black-browed albatross are marine, pelagic birds but commonly come inshore. It is typical for albatross to move toward shore during violent weather. They may travel thousands of kilometers off land in search of food. Their breeding grounds are often on steep slopes with tussock grass, cliff terraces, or level ground.

Habitat Regions: temperate ; terrestrial ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 29628 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24267 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.605 - 16.977
  Nitrate (umol/L): 1.697 - 28.640
  Salinity (PPS): 32.635 - 35.436
  Oxygen (ml/l): 5.500 - 8.188
  Phosphate (umol/l): 0.304 - 2.046
  Silicate (umol/l): 1.379 - 89.471

Graphical representation

Temperature range (°C): -1.605 - 16.977

Nitrate (umol/L): 1.697 - 28.640

Salinity (PPS): 32.635 - 35.436

Oxygen (ml/l): 5.500 - 8.188

Phosphate (umol/l): 0.304 - 2.046

Silicate (umol/l): 1.379 - 89.471
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

For much of the year, black-browed albatrosses are pelagic, spending months on end at sea (2). To breed, they choose islands having steeply sloping coasts with tussock grass, although they will nest on cliffs and on level shores (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Black-browed albatross mainly feed on crustaceans and fish but also squid and carrion (i.e. penguin corpses). A large portion of their diet consists of krill that they locate using a method known as local enhancement. This is when an albatross observes another albatross or foraging species successfully feeding and they come together to take advantage of the food source. They use their webbed feet to paddle themselves around and feed by surface-seizing or surface diving. They have often been known to follow trawlers looking for any discarded catch.

Animal Foods: fish; carrion ; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

  • Grunbaum, D., R. Veit. 2003. Black-browed albatrosses foraging on antarctic krill: density- dependence through local enhancement?. Ecology, Vol. 84 Issue 12: 3265-3275. Accessed March 18, 2010 at http://www.jstor.org.proxy.lib.fsu.edu/stable/3450070?&Search=yes&term=albatross&term=black browed&list=hide&searchUri=%2Faction%2FdoBasicSearch%3FQuery%3Dblack-browed%2Balbatross%26x%3D0%26y%3D0%26hp%3D25%26sorigin%3Dwww.ufv.ca%26cookieSet%3D1&item=2&ttl=263&returnArticleService=showArticle.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

As the main dietary component, fish populations are likely impacted by black-browed albatross. Little is known regarding symbiotic relationships.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black-browed albatross’ main threat is humans but they have also been known to be fed on by tiger sharks. Accidental death by long-line fishing methods poses the greatest threat to black-browed albatross. The recent population decline is believed to be caused by increases in local long-line fishing. In the past, mariners captured albatross for their meat and raided their colonies of nests for the eggs. Albatross eggs are often eaten by rats (Rattus) and chicks are preyed upon by skuas (Stercorarius).

Known Predators:

  • Tiger sharks (Galeocerdo cuvier)
  • Skuas (Stercorarius)
  • Rats (Rattus)
  • Humans (Homo sapiens)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Black-browed albatross are generally silent, but will make a rapid grunting noise within breeding colonies. They also make beak-clapping noises. Breeding pairs will communicate through several different courtship behaviors such as allopreening and beak touching. Like all birds, black-browed albatross perceive their environments through visual, auditory, tactile, and chemical stimuli.

Communication Channels: tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Black-browed albatross in captivity have a maximum lifespan of 32.5 years. In the wild they generally live around 30 or more years but have been known to live as long as 70 years.

Range lifespan

Status: wild:
70 (high) years.

Range lifespan

Status: captivity:
35.2 (high) years.

Average lifespan

Status: wild:
30 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 43.7 years (wild) Observations: In the wild, these animals can live up to 43.7 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Black-browed albatross are monogamous and often mate for life. Pairs often engage in mutualistic feeding rituals. Black-browed albatross often engage in beak touching and allopreening between mates. In general, albatross are well-known for elaborate courtship behaviors.

Mating System: monogamous

Black-browed albatross breed from September or October to April. They are colonial during the breeding season and make their nests out of mud, grass, guano, and seaweed. They build nests that are on a volcano-shaped dome where they incubate a single egg for 71 days. The chicks are born with grayish white down and are brooded for one to four weeks. Chicks fledge after 120 days and they reach sexual maturity after 7 to 9 years.

Breeding interval: Black-browed Albatrosses breed annually.

Breeding season: Black-browed albatrosses breed from September to April.

Average eggs per season: 1.

Average time to hatching: 71 days.

Average fledging age: 120 days.

Range age at sexual or reproductive maturity (female): 7 to 9 years.

Range age at sexual or reproductive maturity (male): 7 to 9 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both parents participate in egg incubation which can last up to 71 days. Chicks are born precocial, with downy feathers and eyes open. Both parents feed the young. Parents tend the hatchling for several months, then abandon the chick before it fledges.

Parental Investment: precocial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female)

  • Falklands Conservation, 2010. "Black-browed albatross" (On-line). Accessed March 19, 2010 at http://www.falklandsconservation.com/wildlife/albatross/black-browed-albatross.html.
  • National Audubon Society, , L. Line, F. Russell. 1976. The audubon society book of wild birds. New York: Harry N. Abrams Incorporated.
  • del Hoyo, J., A. Elliot, J. Sargatal. 1992. Handbook of the birds of the world: ostrich to ducks. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thalassarche melanophris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Thalassarche melanophrys

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTGACCTTCATTAACCGATGACTGTTTTCAACCAACCATAAAGATATCGGCACACTATACTTAATTTTTGGTGCATGAGCCGGCATAGTCGGAACCGCACTCAGCTTACTTATCCGTGCAGAACTTGGTCAGCCAGGAACCCTCCTGGGAGACGACCAAATCTACAATGTAATCGTCACCGCTCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGAAACTGACTAGTACCACTTATAATTGGTGCACCTGACATAGCATTTCCACGTATAAATAATATAAGCTTTTGATTACTACCCCCATCCTTCCTCCTCCTACTAGCATCCTCCACAGTAGAAGCAGGAGCAGGTACAGGATGAACTGTGTACCCGCCTCTAGCTGGCAACCTTGCCCACGCAGGGGCTTCAGTAGACCTGGCTATCTTCTCCCTCCACCTAGCAGGTGTTTCATCAATCCTAGGAGCAATTAACTTCATCACAACTGCCATCAATATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCCGTACTCATTACTGCCGTCTTACTCTTACTTTCACTACCAGTCCTTGCCGCCGGTATTACCATACTACTAACAGATCGAAACCTAAATACTACATTCTTCGACCCAGCTGGAGGAGGGGACCCAGTCCTATATCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTCTACATTTTAATTTTACCTGGCTTTGGAATCATCTCGCATGTAGTAACATACTACGCAGGTAAAAAAGAACCGTTCGGCTACATAGGAATAGTATGAGCCATACTCTCCATTGGATTCCTAGGCTTCATCGTATGGGCCCACCATATATTTACAGTAGGAATAGACGTAGACACTCGAGCATACTTCACATCTGCCACTATAATCATTGCCATTCCCACTGGAATCAAAGTCTTCAGCTGGTTAGCCACCCTACACGGAGGAGCCATTAAATGAGATCCACCCATACTATGGGCCCTAGGGTTTATCTTCCTCTTCACCATCGGAGGACTTACAGGTATCGTCCTGGCAAATTCCTCACTAGATATTGCCCTTCATGACACATACTATGTAGTTGCTCACTTCCACTATGTCCTCTCAATAGGGGCTGTCTTCGCTATCCTAGCAGGATTCACCCACTGATTCCCGCTATTCACAGGGTACACCCTACACCCTACATGAGCTAAAGCCCACTTCGGAGTTATATTTACAGGCGTAAACCTAACCTTCTTCCCACAACACTTCCTAGGCTTAGCCGGTATACCACGACGATACTCCGATTACCCAGATGCTTACACCCTATGAAACACCATATCCTCCATCGGCTCACTAATCTCAATAACCGCCGTAATTATACTAATATTCATTATCTGAGAAGCCTTTGTATCAAAACGAAAAGTCCTACAACCAGAACTAATCTCCACTAACATTGAATGAATCCACGGCTGCCCACCCCCATATCACACCTTCGAAGAGCCAGCCTTCGTTCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thalassarche melanophrys

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s
Arata, J., Croxall, J., Huin, N., Misiak, W., Phillips, R., Robertson, G. & Stanworth, A.

Justification
This species has been downlisted to Near Threatened as it is no longer estimated to be undergoing very rapid population declines. Survey data from the Falkland Islands (Islas Malvinas), holding over 70% of the global population, showed population increases during the 2000s and possibly since the 1980s, and the data suggest reclassification as Least Concern, however there remains a considerable degree of uncertainty over population trends for a significant part of the global population, and trend estimates are heavily influenced by the extrapolation over 65 years of data from a ten-year period. In addition, high levels of mortality of this species are reported from longline and trawl fisheries in the South Atlantic. For these reasons, moderately rapid ongoing declines over three generations since 1980 are precautionarily suspected until further data are forthcoming.


History
  • 2013
    Near Threatened (NT)
  • 2012
    Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Vulnerable (VU)
  • Lower Risk/near threatened (LR/nt)
  • Not Recognized (NR)
  • Not Recognized (NR)