Overview

Brief Summary

Biology

Adults arrive at their breeding colonies between late August and early September, where the female lays a single egg in a nest built on a pedestal of mud. Part of a monogamous pair, both the male and the female contribute to the care of the egg and the hatchling, taking turns to incubate the egg and provide the chick with regurgitated food. The chick fledges in April and May, but do not breed until, on average, the age of ten (3) (4). An agile bird, the Atlantic yellow-nosed albatross often scavenges at fishing vessels and overcomes its size disadvantage by manoeuvring close enough to the boat to retrieve scraps thrown overboard. It will also steal prey from white-chinned petrels and makes use of the hunting tactics of tuna and cetaceans by plunge-diving for the fish they drive to the surface. Its diet consists of fish, crustaceans, squid and fishery by-catch (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A relatively small albatross, the Atlantic yellow-nosed albatross is named after the yellow streak ending in a pink tip along the top of the bill. The head is grey with a white cap, and the upperparts are blackish-grey. There is a white ring around the neck and this white colouration extends across the underside. The underwings are white, and are tipped with a narrow black edge. The sexes are alike, but juveniles have an entirely white head and black bill (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

North America; very rare visitor
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Thalassarche chlororhynchos breeds on Gough and islands in the Tristan da Cunha archipelago, Tristan da Cunha, St Helena (to UK). On Gough, the population was estimated at c.5,300 breeding pairs in 2000-2001 (Cuthbert and Sommer 2004a). In the Tristan da Cunha Island group, the number of breeding pairs per year was estimated to be 16,000-30,000 on Tristan da Cunha Island in 1974, 4,500 on Nightingale Island in 1974, 40 on Middle Island in 2010 (Ryan et al. 2011), 210 on Stoltenhoff Island in 2010 (Ryan et al. 2011), and 1,100 on Inaccessible Island in 1983 (Fraser et al. 1988). A count in 2007 on Nightingale Island re-estimated the population at 4,000 breeding pairs (ACAP 2009). These data give a total of 27,500-41,600 breeding pairs per year, equating to 55,000-83,200 mature individuals. However, given that the Tristan da Cunha data are now over 30 years out of date, there is considerable uncertainty around the overall population estimate. Trend data from study colonies on Tristan was used to produce a revised estimate of c.3,250 pairs in 2001 (Cuthbert and Sommer 2004), equating to a reduction of 80-89% from 1974 levels to 2001. This figure suggests an updated population estimate of c.13,900 breeding pairs, equating to 21,000-32,000 mature individuals, may be more appropriate. Demographic data have been collected from two study colonies on Gough Island and Tristan da Cunha. Annual variation in the number of breeding birds was strongly correlated between the two islands and over the whole study period both study populations have decreased at around 1.1-1.2% per year (Cuthbert et al. 2003). However, population modelling predicts annual rates of decrease of between 1.5-2.8% on Gough Island and 5.5% on Tristan da Cunha (Cuthbert et al. 2003). On Inaccessible Island, a partial count in 1999-2000 suggests that the population may have decreased since the late 1980s (Ryan and Moloney 2000). In the non-breeding season it disperses throughout the South Atlantic Ocean, mainly between 25°S to 50°S, and has been recorded off the coast of Argentina, Brazil and the west coast of southern Africa (Harrison 1983). A single bird collected at Middle Sister Island (Chatham Islands) in the 1970s had recently laid an egg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The Atlantic yellow-nosed albatross breeds on Gough Island and the islands of the Tristan da Cuhna archipelago in the Southern Ocean. In the non-breeding season it is found throughout the South Atlantic Ocean and has been recorded off the coast of Argentina, Brazil and the west coast of southern Africa (2). It occasionally reaches Australian waters (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is an annual breeder. Nests are a pedestal made of mud, peat, feathers and vegetation. Eggs are laid September to early October, and chicks fledge in late March to April. Young birds return to colonies from five years of age, and experienced breeders will attempt to breed in two of every three years. Breeding success ranges from 62-72% and 62-76% for Gough Island and Tristan de Cunha respectively (ACAP 2009). It usually breeds singly or in loose aggregations. It feeds by surface-seizing and occasionally diving, and also feeds in association with marine mammals or gamefish which bring baitfish to the surface. It is strongly attracted to fishing vessels and studies from shelf waters have shown scavenged food can comprise a large proportion of stomach contents. Habitat Breeding It builds nests built on tussock grass, on rocks and under trees. Diet When not scavenging, its diet is largely comprised of fish, but also cephalopods (ACAP 2009). In one study, cephalopods were predominant in the diet of birds caught by longlines, representing 73% of the total mass (Colabuono and Vooren 2007).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 144 specimens in 1 taxon.
Water temperature and chemistry ranges based on 144 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.751 - 19.067
  Nitrate (umol/L): 0.550 - 26.960
  Salinity (PPS): 32.551 - 35.575
  Oxygen (ml/l): 5.360 - 7.843
  Phosphate (umol/l): 0.276 - 1.733
  Silicate (umol/l): 1.610 - 65.005

Graphical representation

Temperature range (°C): -0.751 - 19.067

Nitrate (umol/L): 0.550 - 26.960

Salinity (PPS): 32.551 - 35.575

Oxygen (ml/l): 5.360 - 7.843

Phosphate (umol/l): 0.276 - 1.733

Silicate (umol/l): 1.610 - 65.005
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in lush, dense vegetation from coastal plateaus up to elevations of about 500 meters (pers comm), and is found out in the open ocean during the non-breeding season, in warmer waters than most albatross species (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 37 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassarche chlororhynchos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATACTTAATTTTTGGTGCATGAGCCGGCATAGTCGGAACCGCACTCAGCTTACTTATCCGGGCAGAACTTGGTCAGCCAGGAACCCTCCTGGGAGACGACCAAATCTACAATGTAATCGTCACCGCTCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATCGGAGGATTTGGAAACTGACTAGTACCACTTATAATTGGTGCACCTGACATAGCATTTCCACGTATAAATAATATAAGCTTCTGATTACTACCCCCATCCTTCCTCCTCCTGCTAGCATCCTCCACAGTAGAAGCAGGAGCAGGTACAGGATGAACTGTGTACCCGCCTCTAGCTGGCAACCTCGCCCACGCAGGGGCTTCAGTAGACCTGGCTATCTTCTCCCTCCACCTAGCAGGTGTTTCATCAATCCTAGGAGCGATTAACTTCATCACAACTGCCATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCTGTCCTCATTACTGCCGTCTTACTATTACTTTCACTACCAGTCCTTGCCGCCGGTATTACCATACTACTAACAGATCGGAACCTAAATACTACATTCTTCGACCCAGCTGGAGGAGGAGACCCAGTCCTATATCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTCTACATTTTAATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thalassarche chlororhynchos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4bd;B2ab(v)

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s
Cooper, J., Cuthbert, R., Hilton, G. & Ryan, P.G.

Justification
This species is listed as Endangered as it has a very small breeding range and is estimated to be undergoing a very rapid ongoing decline projected over three generations (72 years) owing to incidental mortality in longline fisheries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The Atlantic yellow-nosed albatross is classified as Endangered (EN) on the IUCN Red List 2004 (1) and as Vulnerable on the Action Plan for Australian Birds (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
On Gough Island, the population was estimated at c.5,300 breeding pairs in 2000-2001 (Cuthbert and Sommer 2004). In 1974, the number of breeding pairs in the Tristan da Cunha group was estimated to be 16,000-30,000 on Tristan da Cunha Island, 4,500 on Nightingale Island, 100-200 on Middle Island, 500 on Stoltenhoff Island (all data from 1974: Richardson 1984), and 1,100 on Inaccessible Island (in 1983, Fraser et al. 1988). However, these data are now >30 years out of date and there is considerable uncertainty around the overall population estimate. It is likely that most populations are considerably reduced since 1974 counts, particularly on Tristan da Cunha Island (estimated to be c. 3,250 in 2001), based on population trend data from study colonies (Cuthbert and Sommer 2004). This equates to a reduction of 80-89% from 1974 levels to 2001. More recent data reports 40 pairs on Middle Island and 210 on Stoltenhoff Island in 2010 (Ryan et al. 2011). Based on the recent trend figures, a more appropriate estimate of total breeding pairs might be 13,900, equating to 27,800 mature individuals (and a range of 21,000-32,000).


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is commonly caught as incidental bycatch in longline fisheries within its range. In particular, there is an estimated mortality of at least 900 birds per annum off the coast of south-east Brazil, where it is known to be one of the commonest species attending longline vessels (Olmos et al. 2000). It is also known to attend trawlers and longlining vessels off the west coast of southern Africa (Harrison 1983, Olmos 1997, Croxall and Gales 1998), where mortality has been recorded (Ryan et al. 2002). It is thought to be one of the most frequently killed species in pelagic and longlining fisheries off Namibia where assessments of seabird bycatch are just emerging (ACAP 2009). The harvest of chicks and adults on Tristan, previously permitted under a local ordinance, is now illegal and poaching is now probably rare. Although house mice Mus musculus and black rats Rattus rattus are present on some breeding islands they have no known effects on breeding success. Inaccessible Island no longer has feral pigs Sus scrofa, which would likely have impacted adults, chicks and eggs (ACAP 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As a scavenger of fishing vessel bait, the Atlantic yellow-nosed albatross is suffering population declines as a result of longline fishing. Longlining is mainly used to catch tuna and swordfish by releasing a line of baited hooks that sink to the appropriate depth for these fish. Many seabirds dive for the bait before it has sunk, becoming caught on the hooks and drowning as the line reaches its final depth. The Atlantic yellow-nosed albatross attends trawlers off the coast of south-eastern Brazil and the west coast of southern Africa (2). It also suffers losses as a result of collisions with cables on trawl vessels (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CMS Appendix II and ACAP Annex 1. It is monitored on Gough Island. Gough and Inaccessible Islands are nature reserves. Gough Island is a World Heritage Site. A population census was conducted in 2000-2001, and a repeatable monitoring protocol was devised (Cuthbert and Sommer 2004b). Remote-tracking of the Gough population took place during 2004-2005, to determine at-sea distribution. Remote-tracking of the Tristan da Cunha population is being undertaken in 2007-2008. Limited counts were made in a few areas of Tristan da Cunha during 2004 and limited monitoring is ongoing. In 2006 the South East Atlantic Fisheries Commission (SEAFO) passed a resolution to require all its longline vessels to use a tori line and to set lines at night.

Conservation Actions Proposed
Census the population on all the islands in the Tristan da Cunha group. Conduct regular monitoring of a more representative proportion of the population and continue monitoring on Gough Island. Assess recent population trends, demographic parameters and modelled trajectory of population. Determine the at-sea distribution of the species through tracking studies (BirdLife International 2004) and the interaction with longline fisheries. Promote the adoption of a) monitoring of seabird bycatch associated with longline fishing and b) best-practice mitigation measures in all fisheries within the species' range, particularly via intergovernmental mechanisms such as ACAP, the FAO, and Regional Fisheries Management Organisations, including the Atlantic tuna commission (ICCAT) and the South East Atlantic Fisheries Commission (SEAFO).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Atlantic yellow-nosed albatross is monitored on Gough Island, which is both a nature reserve and a World Heritage Site. A population census was carried out in 2000/2001 and was repeated in 2004. Remote tracking has also been used in order to determine the distribution of these birds at sea. The information obtained will be used to assess the overlap between the birds and longline fishing operations. Longline fishing is controversial and techniques to reduce the seabird catch have been suggested, such as weighting lines to sink them more rapidly, and setting them at night (2). A Threat Abatement Plan has been put into action by the Australian government, which proposes to promote public awareness of the conservation needs of albatrosses and to reduce the by-catch of this species and other albatross species (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Atlantic yellow-nosed albatross

The Atlantic yellow-nosed albatross (Thalassarche chlororhynchos) is a large seabird in the albatross family. This small mollymawk was once considered conspecific with the Indian yellow-nosed albatross and known as the yellow-nosed albatross. Some authorities still believe the species to be the same, such as Jeff Clements[3] and the SACC, which recognizes that a proposal is needed.[4]

Taxonomy[edit]

Mollymawks are a type of albatross that belong to Diomedeidae family and come from the Procellariiformes order, along with shearwaters, fulmars, storm petrels, and diving petrels. They share certain identifying features. First, they have nasal passages that attach to the upper bill called naricorns, although the nostrils on the albatross are on the sides of the bill. The bills of Procellariiformes are also unique in that they are split into between seven and nine horny plates. Finally, they produce a stomach oil made up of wax esters and triglycerides that is stored in the proventriculus. This is used against predators as well as an energy rich food source for chicks and for the adults during their long flights.[5] They also have a salt gland that is situated above the nasal passage and helps desalinate their bodies, due to the high amount of ocean water that they imbibe. It excretes a high saline solution from their nose.[6]

Description[edit]

The Atlantic yellow-nosed albatross averages 81 cm (32 in) in length. It is a typical black and white mollymawk with a grey head and large eye patch, and its nape and hindneck are white. Its bill is black with a yellow culmenicorn and a pink tip. It has a blackish grey saddle, tail and upperwing, and its underparts are predominantly white. Its underwing and primaries show a narrow black margin. The juvenile is similar to the adult but with a white head and black bill.[7] It can be differentiated from the Indian yellow-nosed by its darker head. Relative to other mollymawks it can be distinguished by its smaller size (the wings being particularly narrow) and the thin black edging to the underwing, The grey-headed albatross has a similar grey head but more extensive and less well defined black markings around the edge of the underwing. Salvin's albatross also has a grey head but has much broader wings, a pale bill and even narrower black borders to the underwing.

Behaviour[edit]

Feeding[edit]

This mollymawk feeds on squid, fish and crustacea.

Breeding[edit]

Juvenile on Nightingale Island

Like all albatrosses they are colonial, but unusually they will build their nests in scrub or amongst Blechnum tree ferns. Like all mollymawks they build pedestal nests of mud, peat, feathers, and vegetation to lay their one egg in. They do this in September or early October, and the chick fledges in late March to April. They breed annually.[7]

Range[edit]

Atlantic yellow-nosed albatrosses nest on islands in the mid-Atlantic, including Tristan da Cunha (Inaccessible Island, Middle Island, Nightingale Island, Stoltenhoff Island) and Gough Island. At sea they range across the south Atlantic from South America to Africa between 15°S and 45°S.[7]

Conservation[edit]

Breeding Population and Trends[7]
LocationPopulationDateTrend
Gough Island5,300 pairs2001Stable
Tristan da Cunha Island16,000 - 30,000 pairs1974Stable
Nightingale Island4,500 pairs1974Declining
Middle Island100 - 200 pairs1974
Stoltenhoff Island500 pairs1974
Inaccessible Island1,100 pairs1983Declining
Total55,000-83,2002001Declining

The IUCN list this species as endangered,[1] with an occurrence range of 16,800,000 km2 (6,500,000 sq mi) and a breeding range of 80 km2 (31 sq mi). A 2001 population estimate breaks down the population and shows some trends. Gough Island has 5,300 breeding pairs,[8] between 16,000 and 30,000 breeding pairs on Tristan da Cunha Island, 4,500 on Nightingale Island, between 100 and 200 pairs on Middle Island, and 500 pairs on Stoltenhoff Island,[9] and 1,100 on Inaccessible Island.[10] This adds up to between 27,500 and 41,600 pairs per year for the total between 55,000 and 83,200 total adult birds. This population estimate was done in 1983, however and is outdated. Trends suggest a 50% decrease over 72 years.[7]

The largest threat is from longline fishing, as harvesting of chicks and adults has been outlawed.

Efforts to help conserve this bird are underway, with counting of the birds on Gough Island. Also, Gough Island and Inaccessible Island are nature preserves, and Gough Island is a World Heritage Site. The Tristan da Cunha population is being remotely tracked and counted, and the South East Atlantic Fisheries Commission has passed a resolution that all fishing vessels use a tori line and drop lines at night.[7]

Footnotes[edit]

  1. ^ a b BirdLife International (2012). "Thalassarche chlororhynchos". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Brands, S. (2008)
  3. ^ Clements, J. (2007)
  4. ^ Remsen Jr., J. V. (2008)
  5. ^ Double, M. C. (2003)
  6. ^ Ehrlich, Paul R. (1988)
  7. ^ a b c d e f BirdLife International (2008)
  8. ^ Cuthbert, R. & Sommer, E. S. (2004)
  9. ^ Richardson, M. E. (1984)
  10. ^ Fraser, M. W. et al. (1984)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!