Overview

Brief Summary

Biology

Adults arrive at their breeding colonies between late August and early September, where the female lays a single egg in a nest built on a pedestal of mud. Part of a monogamous pair, both the male and the female contribute to the care of the egg and the hatchling, taking turns to incubate the egg and provide the chick with regurgitated food. The chick fledges in April and May, but do not breed until, on average, the age of ten (3) (4). An agile bird, the Atlantic yellow-nosed albatross often scavenges at fishing vessels and overcomes its size disadvantage by manoeuvring close enough to the boat to retrieve scraps thrown overboard. It will also steal prey from white-chinned petrels and makes use of the hunting tactics of tuna and cetaceans by plunge-diving for the fish they drive to the surface. Its diet consists of fish, crustaceans, squid and fishery by-catch (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

A relatively small albatross, the Atlantic yellow-nosed albatross is named after the yellow streak ending in a pink tip along the top of the bill. The head is grey with a white cap, and the upperparts are blackish-grey. There is a white ring around the neck and this white colouration extends across the underside. The underwings are white, and are tipped with a narrow black edge. The sexes are alike, but juveniles have an entirely white head and black bill (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Thalassarche chlororhynchos breeds on Gough and islands in the Tristan da Cunha archipelago, Tristan da Cunha, St Helena (to UK). On Gough, the population was estimated at c.5,300 breeding pairs in 2000-2001 (Cuthbert and Sommer 2004a). In the Tristan da Cunha Island group, the number of breeding pairs per year was estimated to be 16,000-30,000 on Tristan da Cunha Island in 1974, 4,500 on Nightingale Island in 1974, 40 on Middle Island in 2010 (Ryan et al. 2011), 210 on Stoltenhoff Island in 2010 (Ryan et al. 2011), and 1,100 on Inaccessible Island in 1983 (Fraser et al. 1988). A count in 2007 on Nightingale Island re-estimated the population at 4,000 breeding pairs (ACAP 2009). These data give a total of 27,500-41,600 breeding pairs per year, equating to 55,000-83,200 mature individuals. However, given that the Tristan da Cunha data are now over 30 years out of date, there is considerable uncertainty around the overall population estimate. Trend data from study colonies on Tristan was used to produce a revised estimate of c.3,250 pairs in 2001 (Cuthbert and Sommer 2004), equating to a reduction of 80-89% from 1974 levels to 2001. This figure suggests an updated population estimate of c.13,900 breeding pairs, equating to 21,000-32,000 mature individuals, may be more appropriate. Demographic data have been collected from two study colonies on Gough Island and Tristan da Cunha. Annual variation in the number of breeding birds was strongly correlated between the two islands and over the whole study period both study populations have decreased at around 1.1-1.2% per year (Cuthbert et al. 2003). However, population modelling predicts annual rates of decrease of between 1.5-2.8% on Gough Island and 5.5% on Tristan da Cunha (Cuthbert et al. 2003). On Inaccessible Island, a partial count in 1999-2000 suggests that the population may have decreased since the late 1980s (Ryan and Moloney 2000). In the non-breeding season it disperses throughout the South Atlantic Ocean, mainly between 25S to 50S, and has been recorded off the coast of Argentina, Brazil and the west coast of southern Africa (Harrison 1983). A single bird collected at Middle Sister Island (Chatham Islands) in the 1970s had recently laid an egg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; very rare visitor
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The Atlantic yellow-nosed albatross breeds on Gough Island and the islands of the Tristan da Cuhna archipelago in the Southern Ocean. In the non-breeding season it is found throughout the South Atlantic Ocean and has been recorded off the coast of Argentina, Brazil and the west coast of southern Africa (2). It occasionally reaches Australian waters (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is an annual breeder. Nests are a pedestal made of mud, peat, feathers and vegetation. Eggs are laid September to early October, and chicks fledge in late March to April. Young birds return to colonies from five years of age, and experienced breeders will attempt to breed in two of every three years. Breeding success ranges from 62-72% and 62-76% for Gough Island and Tristan de Cunha respectively (ACAP 2009). It usually breeds singly or in loose aggregations. It feeds by surface-seizing and occasionally diving, and also feeds in association with marine mammals or gamefish which bring baitfish to the surface. It is strongly attracted to fishing vessels and studies from shelf waters have shown scavenged food can comprise a large proportion of stomach contents. Habitat Breeding It builds nests built on tussock grass, on rocks and under trees. Diet When not scavenging, its diet is largely comprised of fish, but also cephalopods (ACAP 2009). In one study, cephalopods were predominant in the diet of birds caught by longlines, representing 73% of the total mass (Colabuono and Vooren 2007).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 144 specimens in 1 taxon.
Water temperature and chemistry ranges based on 144 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.751 - 19.067
  Nitrate (umol/L): 0.550 - 26.960
  Salinity (PPS): 32.551 - 35.575
  Oxygen (ml/l): 5.360 - 7.843
  Phosphate (umol/l): 0.276 - 1.733
  Silicate (umol/l): 1.610 - 65.005

Graphical representation

Temperature range (°C): -0.751 - 19.067

Nitrate (umol/L): 0.550 - 26.960

Salinity (PPS): 32.551 - 35.575

Oxygen (ml/l): 5.360 - 7.843

Phosphate (umol/l): 0.276 - 1.733

Silicate (umol/l): 1.610 - 65.005
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 144 specimens in 1 taxon.
Water temperature and chemistry ranges based on 144 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -0.751 - 19.067
  Nitrate (umol/L): 0.550 - 26.960
  Salinity (PPS): 32.551 - 35.575
  Oxygen (ml/l): 5.360 - 7.843
  Phosphate (umol/l): 0.276 - 1.733
  Silicate (umol/l): 1.610 - 65.005

Graphical representation

Temperature range (°C): -0.751 - 19.067

Nitrate (umol/L): 0.550 - 26.960

Salinity (PPS): 32.551 - 35.575

Oxygen (ml/l): 5.360 - 7.843

Phosphate (umol/l): 0.276 - 1.733

Silicate (umol/l): 1.610 - 65.005
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in lush, dense vegetation from coastal plateaus up to elevations of about 500 meters (pers comm), and is found out in the open ocean during the non-breeding season, in warmer waters than most albatross species (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 37 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassarche chlororhynchos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATACTTAATTTTTGGTGCATGAGCCGGCATAGTCGGAACCGCACTCAGCTTACTTATCCGGGCAGAACTTGGTCAGCCAGGAACCCTCCTGGGAGACGACCAAATCTACAATGTAATCGTCACCGCTCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATCGGAGGATTTGGAAACTGACTAGTACCACTTATAATTGGTGCACCTGACATAGCATTTCCACGTATAAATAATATAAGCTTCTGATTACTACCCCCATCCTTCCTCCTCCTGCTAGCATCCTCCACAGTAGAAGCAGGAGCAGGTACAGGATGAACTGTGTACCCGCCTCTAGCTGGCAACCTCGCCCACGCAGGGGCTTCAGTAGACCTGGCTATCTTCTCCCTCCACCTAGCAGGTGTTTCATCAATCCTAGGAGCGATTAACTTCATCACAACTGCCATCAACATAAAACCCCCAGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCTGTCCTCATTACTGCCGTCTTACTATTACTTTCACTACCAGTCCTTGCCGCCGGTATTACCATACTACTAACAGATCGGAACCTAAATACTACATTCTTCGACCCAGCTGGAGGAGGAGACCCAGTCCTATATCAACATCTTTTCTGATTCTTTGGTCACCCAGAAGTCTACATTTTAATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thalassarche chlororhynchos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A4bd;B2ab(v)

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s
Cooper, J., Cuthbert, R., Hilton, G. & Ryan, P.G.

Justification
This species is listed as Endangered as it has a very small breeding range and is estimated to be undergoing a very rapid ongoing decline projected over three generations (72 years) owing to incidental mortality in longline fisheries.


History
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Endangered (EN)
  • Lower Risk/near threatened (LR/nt)
  • Not Recognized (NR)
  • Not Recognized (NR)