Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Rynchops niger

A medium-sized (16-20 inches) gull-like bird, the Black Skimmer in summer is most easily identified by its black upperparts, white underparts, and bizarre black and orange bill. In winter, the Black Skimmer becomes slightly grayer on the head and body. Male and female Black Skimmers are similar to one another in all seasons. The Black Skimmer breeds along the Atlantic coast of the United States south of Massachusetts, on the Gulf coast from Florida to northeastern Mexico, and along the coast of southern California south to central Mexico. In winter, this species withdraws from the U.S.Atlantic coast north of North Carolina, and may be found from there south on both coasts to Central America. Other subspecies occur along coasts and on large rivers in South America. Black Skimmers in North America breed on sandy beaches and barrier islands in colonies near those of other seabird species, utilizing similar habitat types during the winter. In South America, inland populations also exist which inhabit sandy river banks. Black Skimmers eat a variety of small fish and crustaceans. In appropriate habitat, Black Skimmers may be observed flying low over calm water. They feed by lowering the bottom half of their bill (which is much longer than the top half) into the water as they fly, quickly closing their bill when the submerged half of the bill touches a small fish. Black Skimmers are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The structure of the black skimmer's beak is related to its specialised foraging technique, which is unique to skimmers (2) (4). A feeding black skimmer flies low over water with the beak open and the lower mandible partially submerged, 'skimming' the water. If the lower mandible comes into contact with a prey item, such as a small fish or crustacean, the upper mandible snaps down while the head and neck double back under the body, securing the prey, which may be swallowed in flight or taken back to land (2) (5). The long beak and relatively long neck allow the skimmer to maintain its body position just above the water surface while skimming (2), and the beak can be opened unusually wide so that the upper mandible remains clear of the water. The knifelike edges of the beak help the bird to grasp slippery prey, and the neck muscles are very strong, enabling prey to be pulled from the water as the skimmer flies past (4). Although the black skimmer may sometimes wade, it does not swim or dive (2). Since skimming is a tactile rather than a visual hunting technique, skimmers are able to hunt at night, when many fish species come closer to the surface and strong daytime winds often lessen (2) (5) (7). Skimmers are the only birds in which the pupil of the eye constricts to a narrow vertical slit, an adaptation that may achieve a greater reduction in the pupil than with a circular opening, protecting the eyes from the bright glare of sunlight on water and sand during the day (2) (8) (10). A social bird, the black skimmer roosts and breeds in colonies ranging in size from a few to thousands of pairs, and is often found in the company of gulls and terns, from which it may derive some protection from predators (2) (3) (5) (8). Large, successful colonies usually occupy the same nest site from year to year (5). The species is monogamous, and both the male and female help to prepare the nest and raise the chicks. The nest is a simple, shallow scrape in the sand, into which two to four eggs are laid, hatching after an incubation period of around 21 to 26 days (2) (5). Both the eggs and the chicks are well camouflaged against the sand (2) (8). The black skimmer chick is quite well-developed and able to leave the nest after about a week, with fledging occurring after 28 to 30 days (2). The first attempts at skimming are made within about two days of the first flight, but initial success is low, and the young black skimmer may be dependent on the adults for a further few weeks (5). Interestingly, the two mandibles of the beak are of equal length on hatching. The lower mandible grows continuously faster than the upper, so that by the time the chick fledges it is already nearly 1 centimetre longer (2) (5). Its growth is kept in check by wear against the muddy or sandy bottom in shallow water, or by breakage on hitting obstructions, meaning that beak length and shape is quite variable between individuals and over time (2). The black skimmer is thought to breed from around the age of one to three years, and may live for up to 20 years in the wild (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The largest of the three skimmer species (4), the black skimmer is an unmistakable bird, best known for its remarkable beak (2) (5). As in all skimmers, this unusual structure is long and deep, with flattened, blade-like mandibles, and the lower mandible is longer than the upper (2) (3) (5) (6). The beak of the black skimmer is bright red at the base and black at the tip, and the upper mandible is slightly downcurved (2) (3) (5). Together with the bright red legs, it provides a colourful contrast to the white underparts and sides of the head, and the black upperparts and cap (3) (5) (6). The eye is somewhat invisible within the black feathering on the head (5), and the body appears unusually front-heavy due to the long beak and large head (2). The wings are long, narrow and pointed (5) (7), and the tail, which is white with a dark central streak, is slightly forked (2) (3) (5). The legs are short, with webbed toes (5) (7). The male black skimmer is significantly larger than the female, with a longer beak, but is similar in colouration (2) (4) (5) (8). Non-breeding adults have a white collar on the neck, and somewhat browner upperparts, while immature birds are browner and more mottled than adults, with a duller beak (2) (3) (5). Three subspecies of black skimmer are recognised. Rynchops niger cinerascens and Rynchops niger intercedens are larger than Rynchops niger niger, and vary in the colour and markings on the wing linings and tail (2) (5) (6). The black skimmer has a relaxed and buoyant flight (2) (3) (5), and calls with an unusual, dog-like nasal “yip” (3) (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Caribbean; North America; northern Cape Cod to Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Rynchops niger, or black skimmers, have a large range. They are found in the Nearctic and Neotropical regions. In North America, they can be found on the Atlantic and Pacific coasts of the United States. Black skimmers are seen as far north as New York and in the south along the coast of the Gulf of Mexico. They occurs along the west coast of North America, from California through Mexico. In South America, they occur virtually throughout the continent. They can be found in each coastal and land-locked country. In the Caribbean, R. niger can be seen as far east as the Virgin Islands and Grenada.

Rynchops niger is a migratory species. Individuals from northern North America winter in the southern United States and South America or the Caribbean. Individuals from southern South America may winter farther north, but only as far as Costa Rica. Typically, northern populations of R. niger migrate south in November.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Burger, J., M. Gochfeld. 1990. The Black Skimmer: Social Dynamics of a Colonial Species. New York: Columbia University Press.
  • 2006. "The IUCN Red List of Threatened Species" (On-line). Rynchops niger. Accessed October 11, 2006 at http://www.iucnredlist.org/search/details.php/49209/all.
  • Hammerson, G., S. Cannings. 2006. "NatureServe Explorer" (On-line). Comprehensive Report Species - Rynchops niger. Accessed October 11, 2006 at http://www.natureserve.org/explorer.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: southern California (Salton Sea, around San Diego), along coast from Sonora to Nayarit, on Pacific coast of South America in Ecuador; locally from Massachusetts (Plymouth), New York (Long Island), and New Jersey south to southern Florida, along Gulf Coast from western Florida to Tabasco, and along Atlantic coast of South America and along some of larger rivers from Colombia to northern Argentina. Most of the U.S. breeding population occurs along Gulf Coast (mainly Louisiana and Texas). NORTHERN WINTER: southern U.S. to southern South America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The black skimmer occurs throughout the Americas, from the United States, through Mexico and Central America, and south into much of South America (9). R. n. niger is the most northerly subspecies, found along the Atlantic and Gulf coasts of the United States, south through Mexico and into Panama. A western population also breeds from southern California to Mexico (2) (5). R. n. cinerascens is found in northern South America and R. n. intercedens in southern South America (2) (3) (5). The species is migratory, with northern populations moving southwards during the winter, and southern populations sometimes wintering on the coast or moving to Central America or the Caribbean (2) (5) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Black skimmers have distinctive physical characteristics with respect to color and shape. The upper part of the body is black and the lower body and forehead are white. Black skimmers have short tails with white spots on them. They have a bright red-orange bill with a black tip. The lower mandible is longer than the upper mandible by 2 to 3 cm. The feet are bright red-orange and webbed.  Rynchops niger juveniles are a mottled brown color and the sexes are indistinguishable from one another. Their upper and lower mandibles are of equal length after hatching but not after fledging.

Black skimmers exhibit sexual dimorphism in that males tend to be larger than females. Males weigh about 365 g while females weigh 265 g. On average, individuals are about 46 cm long and have a wingspan of 112 cm.

Black skimmers are unique in that they have a large pupil with a vertical slit. The eyes are often difficult to see because they are surrounded by feathers.

Range mass: 265 to 365 g.

Range length: 40 to 50 cm.

Average length: 46 cm.

Average wingspan: 112 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Gochfeld, M., J. Burger. 1994. Black skimmer. Pp. 1-29 in A Poole, F Gill, eds. The Birds of North America, Vol. 3 (108), 1st Edition. Philadelphia, PA: American Ornithologists Union & The Academy of Natural Sciences of Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 46 cm

Weight: 255 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

No other North American bird normally has the lower mandible longer than the upper.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

coastal regions (and inland)
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rynchops niger is primarily found in bays, estuaries, lagoons, mudflats, beaches, shell banks, spoil islands, and coastal marshes. Individuals nest mostly on sand, salt marsh mats, and dredge spoil. They often choose sites near terns, including Sterna dougallii and Sterna antillarum.

Average elevation: 0 m.

Habitat Regions: temperate ; tropical ; terrestrial ; saltwater or marine ; freshwater

Terrestrial Biomes: desert or dune

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 25.139 - 25.294
  Nitrate (umol/L): 0.742 - 1.350
  Salinity (PPS): 34.060 - 35.246
  Oxygen (ml/l): 4.698 - 4.801
  Phosphate (umol/l): 0.196 - 0.263
  Silicate (umol/l): 1.716 - 2.886

Graphical representation

Temperature range (°C): 25.139 - 25.294

Nitrate (umol/L): 0.742 - 1.350

Salinity (PPS): 34.060 - 35.246

Oxygen (ml/l): 4.698 - 4.801

Phosphate (umol/l): 0.196 - 0.263

Silicate (umol/l): 1.716 - 2.886
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Primarily coastal waters, including bays, estuaries, lagoons and mudflats in migration and winter (AOU 1983); also quiet waters of rivers and lakes (Stiles and Skutch 1989). Rest on mudflats, sandbars, beaches.

Nests primarily near coasts on sandy beaches, shell banks, coastal and estuary islands, on wrack and drift of salt marshes (especially where traditional beach nesting areas have been lost or where Herring gulls have become abundant), along tropical rivers, salt pond levees (southern California), and locally, on gravelly rooftops; also on dredged material sites. Nests usually in association with or near terns. See Spendelow and Patton (1988) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

R. n. niger feeds mainly in coastal waters that are protected from open surf, such as in estuaries, bays, tidal pools, inlets and creeks. Nesting occurs on sandy beaches, sandbars, islands, shell banks, dredge islands and salt marsh, and the species may also occasionally be found on inland lakes (2) (5) (8). The two southern subspecies nest mainly along sandbars and beaches of inland rivers, at times when water levels are lowest, and also use coastal beaches, lagoons, islands and estuaries (2) (3) (5). The black skimmer has been recorded at elevations of up to 3,800 metres on the shore of Lake Titicaca in Bolivia (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives on U.S. nesting grounds in April-May (Terres 1980). Northern birds winter from southern U.S. south to Argentina and Chile; southern birds winter north in small numbers to Costa Rica; migrants from North America along Costa Rican coast mid-September to late October and early April-late May, migrants from South America May-October (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Black skimmers are piscivores, their diet primarily consists of small fish from 4 to 12 cm in length. Fish that are smaller than 2 cm are fed to young birds. They also eat arthropods, such as crustaceans, and other marine invertebrates.

Fish species eaten include Odonthestes argentinenesis, Brevoortia aurea, Anchoa marinii, Lycengraulis grossidens, Engraulis anchoita, Pomatomus saltatrix, Mugil cephalus, Fundulus heteroclitus heteroclitus, and Anchoa mitchelli.

Black skimmers have a unique foraging behavior in which they fly low over the water while submerging their sharp, elongated lower mandible into the water. Once the prey comes into contact with the lower mandible, the upper mandible closes and the prey is captured. Their method of feeding allows them to be successful nighttime feeders.

Animal Foods: fish; insects; mollusks; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly small fishes, also crustaceans; skims food from surface of water while flying with lower mandible in water. (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Black skimmers are important predators in coastal ecosystems in North and South America. They may play an important role in regulating the populations of small fishes. Rynchops niger is also prey for a variety of larger predators.

It has been argued that R. niger exhibits information parasitism by taking advantage of warning signals from nearby colonies of common terns like Sterna dougallii and Sterna antillarum.

Little is known of parasites that affect R. niger. External parasites are rare, but internal parasites have been identified. The flatworms Parvitaenia ibis (Cestoda) and Stephanoprora denticulata (Trematoda) were present in individuals affected by botulism. Rynchops niger young are often victims of diarrheal epidemics that affect 10 to 15 percent of fledglings. The organism responsible has yet to be isolated and identified.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Black skimmers exhibit anti-predator behavior both actively and passively. Individuals form colonies, and this group living helps them passively avoid predation through spacing and numbers. They also employ vigilance behavior as an antipredator mechanism. Individuals of pairs look in opposite directions, or multiple individuals in a colony are able to look in every direction for approaching predators. When threatened by a predator, individuals in a colony will fly and give warning calls that are spread by neighboring individuals until the alarm radiates throughout the colony.  Although adults do not exhibit cryptic defense, chicks are cryptically colored and able to blend in to their typical surroundings. Rynchops niger juveniles hide in small scrapes near vegetation where they can blend in to their surroundings.

Black skimmers fall prey to many different types of animals. Mammals and predatory birds often eat adults and juveniles alike. Egg predation is also a problem for them, as even ants, like Solenopsis molesta, Lasius neoniger, and Tetramorium caespitum can be a problem to eggs.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Roosts in flocks of up to 100s or 1000s. Forages up to 5.2-8 kilometers from colony (summarized in Gochfeld and Burger 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Black skimmers communicate with each other by both vocalization and displays. Their bark has been commonly described as a low-frequency bark like that of a dog. They bark as an anti-predator response, to warn their neighbors of potential danger, and also give a low-frequency bark to display aggression when neighbors intrude on their territory. The barks of males are of a lower frequency than those of females. Typical barking calls have a high frequency of approximately 6 kHz and the longest of these barks can last about 0.5 sec. These barks are often accompanied by head tosses and an aggressive upright posture. A head toss occurs when black skimmers quickly raise and lower the head and bill. In an aggressive upright posture, black skimmers extend their legs, body, and neck and hold the carpals away from the body. They may also open their bill without making noise.

Another aggressive posture is the low oblique. This posture may follow the upright aggressive posture but is less intense. It is often accompanied by head tosses and soft barks. In the low oblique posture they tilt the body down and extend the tail and wings upward.  To avoid aggression when moving through a colony black skimmers walk with the bill held upright.  When selecting a nesting location, males and females communicate by kicking sand to establish a scrape at that particular spot. This method of communication also allows their neighbors to know where the nest will be made. Black skimmers communicate vocally most often when they are in their own territories.

The tactile senses of black skimmers are important in their foraging behavior. When skimming over the water at night, they use their lower mandibles to make contact with fish and other marine prey before catching them. Their vertical pupils may help their vision during nocturnal feeding or protect their retinas.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: May forage anytime but mostly at dawn, dusk, or at night (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Black skimmers generally live to between 5 and 15 years of age in the wild, but have a maximum lifespan of 20 years in the wild.

Range lifespan

Status: wild:
20 (high) years.

Typical lifespan

Status: wild:
5 to 15 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Black skimmers begin a courtship process once they arrive at a breeding colony. They form dense flocks and form pairs within about one week. Though individuals may change location in the group more than once, males and females are usually paired within a few days and establish territories. They are monogamous and males aggressively protect their mates. Black skimmers exhibit courtship feeding usually during the evening hours. In this process, a male will present a fish to the female. Once the female accepts the fish and holds it in her beak, the male mounts her and copulation occurs. The female will hold the fish in her beak during copulation and swallow the fish afterward. This is a distinct difference between black skimmers and terns, where females usually eat the fish before copulation. If a male cannot find his mate a fish, he may still be successful in courting her by presenting a stick or a leaf. Copulation may occur several times a day.

Mating System: monogamous

Black skimmers breed annually during the warmer months of summer, generally between the end of April until the beginning of September. Clutch size ranges between 4 and 5 eggs. Egg laying occurs over a span of about 8 days and it is uncommon for female black skimmers to lay multiple eggs on the same day. Incubation takes between 21 to 26 days while the time to fledging usually takes about 28 days. Because males are larger on average, they can take up to 31 days to fledge.

On average, females reach sexual maturity around 3 years of age. The youngest breeding female discovered was 11 months old. Males tend to reach sexual maturity around 4 years of age.

Breeding interval: Black skimmers breed once yearly during the summer months.

Breeding season: Breeding occurs between the end of April and early September.

Range eggs per season: 4 to 5.

Range time to hatching: 21 to 26 days.

Range fledging age: 28 to 31 days.

Average time to independence: 6 weeks.

Range age at sexual or reproductive maturity (female): 11 (low) months.

Average age at sexual or reproductive maturity (female): 36 months.

Average age at sexual or reproductive maturity (male): 48 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both sexes of R. niger attend to the eggs during the period of incubation. Black skimmers protect and care for their chicks until the time of fledging, which can take place 28 to 31 days from hatching. Males tend to feed young chicks more than females, but both sexes feed their young. Rynchops niger chicks are protected from overexposure to the elements by their parents. Black skimmers are territorial and protective of their young and will attack other skimmers, including other fledglings from coming near their nest.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Burger, J., M. Gochfeld. 1990. The Black Skimmer: Social Dynamics of a Colonial Species. New York: Columbia University Press.
  • 2006. "The IUCN Red List of Threatened Species" (On-line). Rynchops niger. Accessed October 11, 2006 at http://www.iucnredlist.org/search/details.php/49209/all.
  • Gochfeld, M., J. Burger. 1994. Black skimmer. Pp. 1-29 in A Poole, F Gill, eds. The Birds of North America, Vol. 3 (108), 1st Edition. Philadelphia, PA: American Ornithologists Union & The Academy of Natural Sciences of Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size usually is 4-5. Incubation is by both sexes. Young are tended by both parents. Colony size ranges up to about 1000 along the mid-Atlantic coast, up to 3000-5000 in Louisiana (Spendelow and Patton 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Bill reduces drag: black skimmer
 

The bill of a skimmer bird reduces drag because it is laterally flattened.

     
  "To compensate for the wear caused by friction with the water, the skimmer's lower mandible grows faster than the upper one, and in adult birds it is usually longer. The bill is laterally flattened, which reduces drag to a minimum." (Foy and Oxford Scientific Films 1982:154)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Light attracts fish: skimmer birds
 

The lower mandible of skimmer birds is used to improve their nighttime fishing technique by disturbing phosphorescent plankton in the water, attracting fish to the surface.

       
  "The skimmer…has a unique fishing technique. It hunts at dusk or by night, flying low across the water, opening its beak and trailing its lower mandible in the water as it flies. This creates a line of light in its wake, which attracts fish. The bird then returns along the same path to pick up the fish, its beak snapping shut on contact with an edible object." (Foy and Oxford Scientific Films 1982:154)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rynchops niger

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCAACAAACCACAAAGACATCGGAACCCTGTATCTAATTTTCGGTGCATGAGCTGGTATAGTGGGCACTGCTCTCAGCCTGCTTATCCGCGCAGAACTGGGTCAACCGGGAACCCTCCTAGGAGAT---GACCAAATCTACAATGTAATCGTTACCGCTCACGCCTTTGTAATGATCTTCTTCATAGTAATGCCAATTATAATTGGTGGCTTCGGAAATTGATTGGTCCCACTTATAATCGGCGCCCCCGATATAGCATTCCCTCGCATAAACAATATAAGCTTCTGACTACTCCCCCCATCCTTCCTACTCCTCCTGGCTTCCTCCACAGTAGAAGCCGGAGCAGGTACAGGATGAACCGTATATCCTCCCCTCGCCAGCAACTTAGCCCATGCCGGGGCTTCAGTAGACTTAGCAATCTTCTCCCTCCACCTAGCAGGTGTATCCTCCATCTTAGGTGCTATCAATTTCATCACTACAGCCATCAACATAAAACCTCCAGCCCTATCCCAATACCAAACCCCATTATTCGTATGATCTGTACTTATTACTGCCGTCTTACTACTACTTTCTCTCCCAGTGCTCGCTGCTGGTATCACTATGCTACTAACAGATCGAAACCTAAACACAACATTCTTCGACCCTGCTGGAGGCGGCGACCCAGTGCTATATCAACATCTCTTTTGATTCTTTGGCCACCCAGAAGTATATATTTTAATTCTACCAGGCTTTGGAATCATCTCTCATGTCGTAACATACTATGCAGGCAAAAAAGAGCCATTCGGCTATATAGGAATAGTATGAGCAATACTATCCATTGGCTTCCTAGGCTTTATTGTGTGAGCACACCACATATTTACAGTCGGAATAGATGTAGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rynchops niger

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black skimmers are abundant and not in any serious danger of decline. Therefore, the IUCN Red List has the species listed under "Least Concern." Black skimmers are also protected by the US Migratory Bird Act.

Black skimmers were once hunted nearly to extinction for food, but are not threatened by hunting anymore. The coastal habitat of R. niger makes these birds vulnerable to human interference through construction, recreational water activities, fishing, crabbing, clamming, and dredging. In addition, like many birds, black skimmers are susceptible to environmental contaminants. The presence of pesticides can lead to shell thinning in eggs while other pollutants can lead to the formation shell-less eggs. Oil pollution and high levels of metal contamination found in R. niger are concerns as well.

US Migratory Bird Act: protected; no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Range is large, and species is relatively common in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Human predation on eggs poses a threat to many accessible colonies in Amazon (Hilty and Brown 1986). In the eastern U.S., major threats include flooding of nests, predation, and human disturbance (Buckley and Buckley 1984). Human disturbance reduces breeding success even in undisturbed areas (increases density of breeding birds there).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the 19th Century, the black skimmer population was greatly reduced due to intense egg collection and hunting for feathers and food (2) (5) (8). Although the species occurs over a large geographical range and currently has a relatively large global population (9), it still faces a number of threats. In the United States, human disturbance at breeding sites is a major cause of colony failure, with sandy beaches increasingly being used for recreation and commercial development, or suffering disturbance from people, dogs and off-road vehicles (2) (5) (8). Even slight disturbances can affect nesting success (8), reducing hatching and fledging and even causing adults to abandon the colony (5) (11). Despite being protected by law, the eggs are sometimes still taken, and in some areas the deliberate destruction of eggs and chicks and the shooting of adults is a problem (2) (5). Predators associated with humans, particularly dogs, cats and rats, may damage some colonies, and chemical pollution is also of concern, with organochlorines and heavy metals thought to accumulate in the eggs and feathers when the black skimmer feeds on contaminated fish (2). In South America, the rivers along which the black skimmer breeds are often the focus of human settlement, and increasing use of beach habitat by humans, as well as the collection of eggs and the possible depletion of fish stocks, poses a threat to many colonies (2) (3). The black skimmer is quite adaptable in its use of feeding and nesting sites, often using man-made ponds and ditches, and breeding on gravel roofs and on areas of dredge deposition from oil exploration. However, the use of these artificial habitats results to a large extent from the black skimmer being displaced from natural beaches. Although adapted to endure natural disasters and heavy predation by readily changing colony site and re-nesting, the species is dependent on areas of open, calm water with a high concentration of fish, and so is vulnerable to any threats to fish populations, such as from oil spills or chemical pollution (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The future of the black skimmer is dependent on the protection of suitable breeding habitat, which is an ongoing problem as human populations expand and are increasingly attracted to beach areas. Larger colonies tend to be more stable, and can be protected by preventing development at breeding sites, restricting access by off-road vehicles, erecting fences and educational signs, and wardening to prevent egg collection and to keep dogs out (5) (8). Annual monitoring of black skimmer populations, which can easily be done from the air to minimise disturbance, has been recommended in order to provide estimates of breeding numbers, and to identify sites needing protection. Monitoring and protection are also needed for fish stocks, to ensure that the quality and quantity are maintained and that any potential effects of pollutants in the food chain identified (5) (8). In South America, it is hoped that the preservation of large stretches of river and adjacent forest to protect local fishing industries will go some way to helping protect the populations of this remarkable bird (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Black skimmers often establish colonies on sandy beaches that could be tourist destinations. Once a colony is established, it is rare for them to leave. For example, black skimmers established a colony in the parking lot at a Dow Chemical Company facility in Texas, making it inaccessible to employees of the company.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Black skimmers were commonly hunted for food before the twentieth century, but are no longer hunted. Their eggs are still valuable to collectors and for food.

Rynchops niger also promotes ecotourism. Breeding colonies attract birders.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Eggs are harvested by humans in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black Skimmer

The Black Skimmer (Rynchops niger) is a tern-like seabird, one of three very similar birds species in the skimmer family. It breeds in North and South America. Northern populations winter in the warmer waters of the Caribbean and the tropical and subtropical Pacific coasts, but the South American races make only shorter movements in response to annual floods which extend their feeding areas in the river shallows.

Description[edit]

In Florida, USA

The Black Skimmer is the largest of the three skimmer species. It measures 40–50 cm (16–20 in) long with a 107–127 cm (42–50 in) wingspan.[2] This species ranges from 212 to 447 g (7.5 to 15.8 oz), with males averaging about 349 g (12.3 oz), as compared to the smaller female’s 254 g (9.0 oz).[3] The basal half of the bill is red, the rest mainly black, and the lower mandible is much-elongated. The eye has a dark brown iris and catlike vertical pupil, unique for a bird. The legs are red. The call is a barking kak-kak-kak.

Adults in breeding plumage have a black crown, nape and upper body. The forehead and underparts are white. The upper wings are black with white on the rear edge, and the tail and rump are dark grey with white edges. The underwing colour varies from white to dusky grey depending on region.

Non-breeding adults have paler and browner upperparts, and a white nape collar. Immature birds have brown upperparts with white feather tips and fringes. The underparts and forehead are white, and the underwings as the adult.

Feeding habits[edit]

In Quintana, Texas Feeding

Skimmers have a light graceful flight, with steady beats of their long wings. They feed usually in large flocks, flying low over the water surface with the lower mandible skimming the water (in order of importance) for small fish, insects, crustaceans and molluscs[4] caught by touch by day or especially at night.

They spend much time loafing gregariously on sandbars in the rivers, coasts and lagoons they frequent.

Taxonomy[edit]

The Black Skimmer has three subspecies:

  • Migratory R. n. niger breeds on the Atlantic coast of North America, and from southern California to Ecuador in the Pacific.
  • R. n. cinerescens is larger, has dusky underwings, and only a narrow white fringe to its black tail, and breeds in northern and northeastern South America and the Amazon basin.
  • R. n. intercedens occurs on the rest of the Atlantic coast of South America south to central Argentina.

Breeding[edit]

The Black Skimmer breeds in loose groups on sandbanks and sandy beaches in the Americas, the three to seven heavily dark-blotched buff or bluish eggs being incubated by both the male and female. The chicks leave the nest as soon as they hatch and lie inconspicuously in the nest depression or "scrape" where they are shaded from high temperatures by the parents. They may dig their own depressions in the sand at times. Parents feed the young almost exclusively during the day with almost no feeding occurring at night, due to the entire population of adults sometimes departing the colony to forage. Although the mandibles are of equal length at hatching, they rapidly become unequal during fledging.

Development[edit]

Notes[edit]

  1. ^ BirdLife International (2012). "Rynchops niger". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ [1] (2011).
  3. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  4. ^ Mariano-Jelicich, R; Favero, M. and Silva, M.P. (February 2003). "Fish Prey of the Black Skimmer Rynchops Niger at Mar Chiquita, Buenos Aires Province, Argentina". Marine Ornithology 31: 199–202. Retrieved 2009-06-29. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!