Articles on this page are available in 1 other language: Spanish (6) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Progne tapera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATTAACCGATGATTATTCTCAACAAACCACAAAGATATCGGAACCCTATACCTAATTTTCGGCGCATGAGCAGGAATAGTAGGAACCGCCCTCAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGCGCCCTTCTTGGCGACGACCAAATCTACAACGTAGTCGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATACCAATCATAATTGGAGGATTCGGAAACTGACTAGTCCCACTAATGATTGGCGCTCCAGACATAGCTTTCCCTCGAATAAACAACATAAGCTTCTGACTCCTCCCCCCATCCTTCCTCCTCCTCCTAGCCTCCTCCACAGTAGAAGCAGGGGTAGGAACCGGCTGAACCGTCTACCCGCCCCTAGCCGGAAATCTAGCCCACGCCGGCGCCTCCGTAGACCTAGCCATTTTCTCCCTACACCTAGCAGGAATCTCTTCGATCCTAGGGGCAATCAACTTTATCACTACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTACTAATCACTGCAGTACTACTCCTTCTCTCACTCCCTGTTCTAGCCGCCGGCATCACCATGCTGCTAACAGACCGTAATCTCAACACCACCTTCTTCGACCCAGCCGGAGGAGGAGACCCAGTACTCTACCAGCATCTATTCTGATTCTTCGGCCACCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Progne tapera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brown-chested Martin

The brown-chested martin (Progne tapera) is a species of passerine bird in the swallow family.

It is found in Argentina, Bolivia, Brazil, Chile, Colombia, Costa Rica, Ecuador, French Guiana, Guyana, Panama, Paraguay, Peru, Puerto Rico, Suriname, the United States, Uruguay, Venezuela, and is a vagrant to Chile and the Falkland Islands. Its natural habitats are dry savanna, subtropical or tropical seasonally wet or flooded lowland grassland, rivers, and heavily degraded former forest.

It usually swoops at low heights, showing white on the sides of its tail, with wings bowed. It may dig burrows into banks to nest (or occasionally in snags) or sometimes use old hornero nests.[2]

References[edit]

  1. ^ BirdLife International (2012). "Progne tapera". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Robert S. Ridgely and Guy Tudor, Field guide to the songbirds of South America: the passerines, 1st ed. University of Texas Press, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!