Overview

Brief Summary

Poecile carolinensis

A small (4 ½ inches) songbird, the Carolina Chickadee is most easily identified by its gray back and tail, pale breast, black chin, and black cap. However, positive identification of this species is complicated where its range overlaps with that of the closely related Black-capped Chickadee (Poecile atricapillus). Carolina Chickadees are generally smaller and darker-winged than their northern relatives, but it is often impossible to separate the two species in the field by physical appearance alone. Hybrids with mixed physical and vocal characteristics do occur, further complicating identification. Male and female Carolina Chickadees are similar to one another in all seasons. The Carolina Chickadee breeds across much of the southeastern United States from the Mid-Atlantic south to central Florida and west to Texas. This species’ range overlaps with that of the Black-capped Chickadee in a narrow band stretching from the Mid-Atlantic region west to Kansas, particularly where that species’ range dips southward at higher elevations in the lower Appalachian Mountains. Carolina Chickadees are generally non-migratory. Carolina Chickadees inhabit a number of forest types, including deciduous and mixed deciduous-evergreen woodland habitats. This species also utilizes human-altered habitats, and may be found in urban and suburban areas where food and sufficient tree cover are available. Carolina Chickadees eat a variety of plant and animal foods, with insects predominating in summer and seeds becoming more important in winter. In appropriate habitat, Carolina Chickadees may be observed foraging for food in the tree canopy, often hanging from the ends of branches while eating seeds or picking insects off of leaves and bark. This species is also a common backyard feeder bird, visiting feeding trays as part of mixed flocks of small songbirds. This species’ song, a whistled “fee-bee, fee-bay” and its call, a clear “chick-a-dee-dee-dee,” are both higher-pitched than those of the Black-capped Chickadee. Carolina Chickadees are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Poecile carolinensis is native to the American Southeast, and is divided into four races: P. c. carolinensis, P. c. extima, P. c. atricapilloides, and P. c. agilis.  Poecile c. carolinensis is found in the southeastern United States; its range covers all of Mississippi, Alabama, Georgia, and South Carolina; northern half of Florida; eastern regions of Arkansas and Louisiana; and the central eastern and northern regions of Tennessee and North Carolina. Poecile c. extima is the northernmost sub species, extending from the southern half of New Jersey across lower Pennsylvania, the central and lower counties of Ohio, Indiana, and Illinois, and the southeastern corner of Missouri. The southern boundary of extimus is the Kentucky – Tennessee border and the Virginia – North Carolina boundary. The species does not occur in the southeastern section of Virginia and in the higher elevations of the Appalachian Mountains. Poecile c. atricapilloides, the westernmost chickadee race, is found along the Kansas – Oklahoma border, central Oklahoma, and the eastern half of the Texas panhandle, extending south almost to the Mexican border. Poecile c. agilis resides in the regions between P. c. carolinensis and P. c. atricapilloides.

Biogeographic Regions: nearctic (Native )

  • Mostrom, A., R. Curry, B. Lohr. 2002. Carolina chickadee (Poecile carolinensis). The Birds of North America, 636.
  • Cornell Laboratory of Ornithology. 1999. "Carolina Chickadee (Poecile carolinensis)" (On-line). Accessed April 10, 2005 at http://www.birds.cornell.edu/bow/carchi/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Resident from southern Kansas east to central Indiana, southern Pennsylvania, and central New Jersey south to southern Texas, Gulf Coast, and northern peninsular Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The following is a general description for all four recognized races (P. c. carolinensis, P. c. extima, P. c. atricapilloides, and P. c. agilis). About twelve centimeters in length with black crown, throat, and lower neck (forming the recognizable “bib”). Chickadees have a white cheek and underparts. The wings and tail are a lighter grey, while the sides and flanks are tinged buffy. Poecile carolinensis is similar in characteristics in both juvenile and adult with juveniles being slightly duller in color. Females are slightly smaller than males. Weight ranges from 9 to 12 grams.

Carolina chickadees are very similar in appearance to their close relative, black-capped chickadees (Parus atricapillus). These two species co-occur in the mountains of Pennsylvania, Maryland, Virginia, and West Virginia. There are subtle differences in the amount of white on outer primary feathers, the tail to wing ratio, and overall length. However, hybridization does occur and hybrids may be morphologically intermediate. Songs vary and can be intermediate as well, so can't be used to distinguish these species in sympatry.

Range mass: 9 to 12 g.

Average length: 12 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 12 cm

Weight: 11 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The amount of white on the outer edge of the greater coverts is the best character for distinguishing PARUS ATRICAPILLUS and P. CAROLINENSIS in the field, but birds in the contact zone may not be identified with certainty (Robbins 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Deciduous woodland, forest clearings and edge, swamps, thickets, second-growth woodland, parks, brushy areas, suburban areas. At night, especially in winter, roosts in cavities if available. Nests in cavity in tree or fence post, and in woodpecker holes and artificial cavities, including artificial snags (Grubb and Bronson 1995, Condor 97:1067-1070). Natural sites with decayed wood usually are excavated by birds themselves. Nests usually about 1-5 m above ground (Harrison 1978). See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Temperate forests, preferably those bordering clearings or near waterways. Forest types inhabited include swamp, hardwood, and mixed pine forests. Tree species characteristic of these forests include oaks (Quercus), water tupelo (Nyssa aquatica) and black gum (Nyssa sylvatica), sweetgum (Liquidamber styraciflua), cypress (Taxodium), elm (Ulmus), ash Fraxinus), cottonwood (Populus deltoides or P. heterophylla), maples (Acer), tulip poplar (Liriodendron tulipifera), beech (Fagus), hickories (Carya), pines (Pinus), and hemlock (Tsuga canadensis). Additional habitats used include parks and wooded urban areas. In the western portion of its range, Carolina chickadees are restricted to riparian habitats. Poecile carolinensis is generally found inhabiting higher elevations in the absence of black-capped chickadees (P. atricapillus), another species of chickadee that often intermingles in habitat: up to 1200 meters locally in Tennessee (usually 850 meters where the species co-occur) and 1850 meters locally in North Carolina (usually 1380 meters where they co-occur). Poecile carolinensis is believed to be non-migratory.

Range elevation: 850 to 1850 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Wetlands: swamp

Other Habitat Features: urban ; suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats insects, especially moths and caterpillars, insect eggs, spiders, fruits, and seeds (Terres 1980). Gleaner; searches bark and leaves.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Carolina chickadees are omnivorous, eating wild seeds and fruits, as well as small insects and spiders. During the warm months, 80-90% of a chickadees diet is likely to be animal foods. During the winter months they will eat seeds and fruits equally with insects and spiders. They primarily forage on the limbs and trunks of trees (arboreal gleaning), as well as in leaf litter and fallen pine cones. During the colder months, when food is sparse, these chickadees may expand their diet. Poecile carolinensis and other chickadee species that overlap geographically are not believed to compete for food, due to increased dietary generalization. Carolina chickadees frequent bird feeders throughout their range.

Analysis of stomach contents in a population from Florida included the following items: 62% insects (Lepidoptera, Hemiptera, Hymenoptera, and Homoptera), 10% arachnids (Arachnida), 28% plant foods (poison ivy (Rhus radicans), blackberry (Rubus), and blueberry (Vaccinium). Other fruits and seeds eaten include: pine (Pinus), mulberry (Morus), honeysuckle (Lonicera), ragweed (Ambrosia), redbud (Cercis canadensis), and Virginia creeper (Parthenocissus quinquefolia).

Animal Foods: amphibians; insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore ); herbivore (Frugivore , Granivore ); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Carolina chickadees are important predators on seeds and small insects and insect larvae in the ecosystems in which they live. They are also prey for small avian, mammalian, and snake predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

At least one study suggests that Carolina chickadees prefer to nest in the inner areas of woodlots. Though they may forage on the outskirts of woodlots, that area is also preferred by Troglodytes aedon, common house wrens. These wrens often destroy chickadee nests on the woodlot border. Other predators of eggs and nestlings include red-bellied woodpeckers (Melanerpes carolinus), racoons (Procyon lotor), Virginia opossums (Didelphis virginiana), domestic cats (Felis silvestris), southern flying squirrels (Glaucomys volans), and rat snakes (Elaphe). Sharp-shinned (Accipiter striatus) and Cooper's hawks (A. cooperii) prey on adults.

Responses to predators includes mobbing by mated pairs, alarm calls, becoming immobile when a predator is detected, and a snake display, in which the chickadee bangs its head and feathers against the material of the nest and hisses at the same time. Most predation on young is avoided through careful choice of nest cavity and predation on adults is avoided by vigilance.

Known Predators:

  • Doherty, P., T. Grubb. 2002. Nest usurpation is an ‘edge effect’ for Carolina chickadees Poecile carolinensis. Journal of Avian Biology, 33: 77-82.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Breeding density usually about 7-12 pairs/40 ha. Forms small flocks in nonbreeding season. In Illinois, predation was the greatest influence on nesting success (Condor 94:371-382). Use of bird feeders enhances winter survival.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like other species of chickadees, P. carolinensis utilizes vocalizations to establish and maintain social communication. There are four notes to the calls, and each call can be varied so as to give a certain implication. These highly structured calls are important in the fall and winter months for communication between birds that are searching for food and maintaining organization of the flock. During the mating period it is believed that vocal communication is less significant. A wide variety of other vocalizations is used, including alarm calls, whistles, gargles, and the characteristic "chick-a-dee."

Communication Channels: visual ; acoustic

  • Clucas, B., T. Freeberg, J. Lucas. 2004. Chick-a-dee call syntax, social context, and season affect vocal responses of Carolina chickadees (Poecile carolinensis). Behavioral Ecology and Sociobiology, 57: 187-196.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Banding studies show that Carolina chickadees may live as long as ten years and 11 months. Annual survival rates from several studies were estimated from 41 to 61% in Maryland, Ohio, and southeastern and southcentral populations. Food supplementation at bird feeders has been demonstrated to increase survivorship over the winter.

Range lifespan

Status: wild:
11 (high) years.

Average lifespan

Status: wild:
131 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutch size is 3-8 (commonly 6). Incubation, by female or by both sexes, lasts 11-14 days. Young are tended by both parents, leave nest at 13-17 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Carolina chickadees begin to find mates during the winter. Males begin to sing and become aggressive towards other members of the flock at this time. Mated pairs may be together for only a single season, but evidence suggests that if both breeders survive through the winter they will mate again in subsequent breeding seasons, essentially mating for life. Nest building and egg laying begin from February to April, with timing related to latitude (February in southern parts of the range, April in Ohio and the central Appalachians).

Mating System: monogamous

Poecile carolinensis nests in holes in tree limbs or dead or decaying trees in which cavities can easily be constructed. They will also use birdhouses (especially if sawdust is provided) or cavities constructed by other bird species (such as woodpecker holes). Chickadees frequently begin construction on several cavities before focusing on only one. Both males and females work on construction of the cavity, which usually takes two weeks, but only the female will actually build the nest. The nest consists of soft natural materials, such as the female’s downy feathers, and dry plant matter, including moss. After the eggs are laid, the female will continue to add nest material to ‘blanket’ her eggs while she is away from the nest. Eggs are often hidden under this layer, making it possible to mistake an active nest with one still under construction.

Females lay a single off-white, reddish-brown spotted egg each day until they have their complete brood, between 3 and 10 eggs. Brood size may increase with increasing latitude, average brood size is 5.8. Incubation typically begins when the last egg is laid. Eggs are incubated for from 12 to 15 days (average 12.9) and hatchlings are brooded for 8 days by the female exclusively. Both parents feed the young once they've hatched. Fledging occurs 16 to 19 days after hatching, it may take up to 3 days for the entire brood to fledge. The young become independent 2 to 3 weeks after fledging, join flocks of immature chickadees, and become sexually mature in the first year following their hatching.

Breeding interval: Poecile carolinensis breeds once in the spring, there are few reports of repeat nesting.

Breeding season: Mating begins in February and continues into April.

Range eggs per season: 3 to 10.

Average eggs per season: 5.8.

Range time to hatching: 12 to 15 days.

Average time to hatching: 12.9 days.

Range fledging age: 16 to 19 days.

Range time to independence: 4 to 6 weeks.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 6.

Both the male and female are partners in the rearing of young. Females alone incubate the eggs and brood the young until they are 8 days old. During the incubation period the male will feed his mate. Once hatched, the young are completely dependent upon the parents for survival. The male will feed the young for the first three or so days after hatching after which the female begins to feed them as well. Males and females protect their young against nest predation and nest parasitism by brown-headed cowbirds (Molothrus ater).

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Mostrom, A., R. Curry, B. Lohr. 2002. Carolina chickadee (Poecile carolinensis). The Birds of North America, 636.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Poecile carolinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTTATCTTCGGCGCGTGAGCCGGAATGGTAGGAACCGCCCTAAGCCTCCTCATCCGTGCAGAACTAGGCCAACCCGGCGCTCTCCTGGGAGACGACCAAATCTACAACGTGATCGTTACAGCCCATGCCTTCGTAATAATCTTCTTCATGGTCATACCAATTATAATCGGAGGATTCGGAAACTGATTAGTCCCCCTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGCTTTTGACTCCTACCCCCCTCCTTCCTACTCCTACTAGCCTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGGTGAACAGTCTACCCACCCCTAGCCGGCAACCTAGCCCACGCCGGAGCATCAGTAGATCTAGCCATCTTCTCCCTACACCTAGCAGGTATCTCATCAATCCTAGGGGCAATCAACTTCATCACAACCGCAATCAACATAAAACCACCCGCCCTCTCACAATACCAAACTCCCCTGTTTGTCTGATCCGTACTAATTACTGCAGTCCTCCTCCTACTCTCACTCCCAGTCCTCGCCGCCGGCATCACTATGCTCCTCACCGACCGTAACCTCAACACCACCTTCTTTGACCCTGCGGGAGGAGGAGACCCAGTGCTCTACCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Poecile carolinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Because it is a common species throughout its region, no efforts have focused attention on the conservation of P. carolinensis. Some local populations may be decreasing, however, while others are increasing. The increase is most often directly linked to human feeders. Additionally, urban population nesting sites decrease as wooded areas are cleared for development or municipal removal of dead and decaying trees.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of P. carolinensis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Carolina chickadees are delightful birds to watch and frequently visit bird feeders. Their predation on insects, larvae, and eggs may help to control pest populations. They are known to eat certain common pest species that are often avoided by other birds, including hairy Geometridae and Arctiidae caterpillars, katydid eggs (Orthoptera), wheel bugs (Arilus), and bees and ants (Hymenoptera).

Positive Impacts: ecotourism ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Carolina chickadee

The Carolina chickadee (Poecile carolinensis) is a small passerine bird in the tit family Paridae. It is often placed in the genus Parus with most other tits, but mtDNA cytochrome b sequence data and morphology suggest that separating Poecile more adequately expresses these birds' relationships (Gill et al., 2005). The American Ornithologists' Union has been treating Poecile as distinct genus for some time already.

Description[edit]

Adults are 11.5–13 cm (4.5–5.1 in) long with a weight of 9–12 g (0.32–0.42 oz), and have a black cap and bib with white sides to the face. Their underparts are white with rusty brown on the flanks; their back is grey. They have a short dark bill, short wings and a moderately long tail. Very similar to the black-capped chickadee, the Carolina chickadee is distinguished by the slightly browner wing with the greater coverts brown (not whitish fringed) and the white fringing on the secondary feathers slightly less conspicuous; the tail is also slightly shorter and more square-ended.

Vocalization[edit]

The calls and song also differ subtly to an experienced ear: the Carolina chickadee's chick-a-dee call is faster and higher pitched than that of the black-capped chickadee, and the Carolina chickadee has a four note fee-bee-fee-bay song, whereas the Black-capped omits the high notes. Identification is very difficult even with an excellent view.

The most famous call is the familiar chick-a-dee-dee-dee which gave this bird its name and its song is fee-bee-fee-bay.

Carolina chickadees are so similar to black-capped chickadees that they themselves have trouble telling their species apart. Because of this they sometimes mate producing hybrids. The most obvious difference between the three chickadees is that the Carolina chickadee sings four-note song, black-capped sing two-note songs, and the hybrids sing three-note songs.[1]

Distribution and habitat[edit]

A Carolina chickadee cavity nest site, previously red-bellied woodpecker

Their breeding habitat is mixed or deciduous woods in the United States from New Jersey west to southern Kansas and south to Florida and Texas; there is a gap in the range at high altitudes in the Appalachian Mountains where they are replaced by their otherwise more northern relative, the black-capped chickadee. They nest in a hole in a tree; the pair excavates the nest, using a natural cavity or sometimes an old woodpecker nest. They may interbreed with black-capped chickadees where the ranges overlap, which can make identification difficult.

They are permanent residents, not usually moving south even in severe winter weather.

Diet[edit]

These birds hop along tree branches searching for food, sometimes hanging upside down or hovering; they may make short flights to catch insects in the air. Insects form a large part of their diet, especially in summer; seeds and berries become important in winter. They sometimes hammer seeds on a tree or shrub to open them; they also will store seeds for later use.

During the fall migration and winter, chickadees often flock together. Many other species of birds, including titmice, nuthatches, and warblers can often be found foraging in these flocks. Mixed flocks stay together because the chickadees call out whenever they find a good source of food. This calling out forms cohesion for the group, allowing the other birds to find food more efficiently.

Temperature regulation[edit]

Carolina chickadee on a branch

Carolina chickadees are able to lower their body temperatures to induce an intentional state of hypothermia called torpor. They do this to conserve energy during extremely cold winters. In extremely cold weather conditions they look for cavities where they can hide in and spend up to fifteen hours at a time in torpor; during this time they are awake but unresponsive; they should not be picked up and handled at this time, as the stress of being held may cause their death.

References[edit]

Study[edit]

  • Todd M Freeberg (2006) Social Complexity Can Drive Vocal Complexity: Group Size Influences Vocal Information in Carolina Chickadees. DOI 10.1111/j.1467-9280.2006.01743
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly in genus Parus; transferred to Poecile by AOU (1997). See DeBenedictis (1987, Birding 19:42-45) for review of hybridization between P. carolinensis and P. atricapillus; the two taxa hybridize freely wherever they meet and easily could be regarded as conspecific.

MtDNA haplotypes of carolinensis divide into eastern and western sets that have diverged by 3%; this population structure may correspond to the Tombigbee River/Mobile Bay disjunction known in some other vertebrate taxa (Gill et al. 1993); the pattern of mtDNA variation does not correspond well with the named subspecies. Phylogenetic analyses indicate that North American chickadees comprise two clades, hudsonicus-rufescens-sclateri versus carolinensis-atricapillus-GAMBELI, and that carolinensis and atricapillus are not sister species (Gill et al. 1993). See Sheldon et al. (1992) for DNA-DNA hybridization evidence of phylogenetic relationships among major lineages of Parus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!