Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Brief Summary

Poecile atricapillus

A small (4 ¾ -5 ¾ inches) songbird, the Black-capped Chickadee is most easily identified by its gray back and tail, pale breast, black chin, and black cap. However, positive identification of this species is complicated where its range overlaps with that of the closely related Carolina Chickadee (Poecile carolinensis). Black-capped Chickadees are generally larger and paler-winged than their southern relatives, but it is often impossible to separate the two species in the field by physical appearance alone. Hybrids with mixed physical and vocal characteristics do occur, further complicating identification. Male and female Black-capped Chickadees are similar to one another in all seasons. The Black-capped Chickadee breeds across much of southern Alaska, Canada, and the northern half of the United States. This species’ range overlaps with that of the Carolina Chickadee in a narrow band stretching from the Mid-Atlantic region west to Kansas, particularly where this species’ range dips southward at higher elevations in the lower Appalachian Mountains. Black-capped Chickadees are generally non-migratory, although small groups may wander at times when food is scarce. Black-capped Chickadees inhabit a number of forest types, including deciduous and mixed deciduous-evergreen woodland habitats. This species also utilizes human-altered habitats, and may be found in urban and suburban areas where food and sufficient tree cover are available. Black-capped Chickadees eat a variety of plant and animal foods, with insects predominating in summer and seeds becoming more important in winter. In appropriate habitat, Black-capped Chickadees may be observed foraging for food in the tree canopy, often hanging from the ends of branches while eating seeds or picking insects off of leaves and bark. This species is also a common backyard feeder bird, visiting feeding trays as part of mixed flocks of small songbirds. This species’ song, a whistled “fee-bee-bee,” and its call, a clear “chick-a-dee-dee-dee,” are both lower-pitched than those of the Carolina Chickadee. Black-capped Chickadees are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: This species is resident from western and central Alaska eastward across central and southern Canada to Newfoundland, and south to northwestern California, southern Utah, central New Mexico, Kansas, central Missouri, central Indiana, and northern New Jersey, and at higher elevations to the southern Appalachians (AOU 1998). Wanders irregularly south in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Black-capped chickadees live only in North America. They can be found from Alaska through the southern half of Canada and as far south as the northern half of the United States.

Biogeographic Regions: nearctic (Native )

  • Smith, S. 1993. "Black-capped Chickadee (Poecile atricapillus)" (On-line). Birds of North America Online. Accessed July 09, 2008 at http://bna.birds.cornell.edu/bna/species/039.
  • Sibley, D. 2000. The Sibley Guide to Birds. New York: Chanticleer Press, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The black-capped chickadee is resident from western and central Alaska,
most of Canada south of the arctic circle, south to extreme northwestern
California, extreme northeastern Nevada, northern New Mexico, central
Indiana, and northern New Jersey. At upper elevations in the
Appalachians its range extends farther south [6,31].
  • 6. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 31. Smith, Susan M. 1993. Black-capped chickadee. In: Poole, A.; Stettenheim, P.; Gill, F., eds. The birds of North America. No. 39. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-20. [24337]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
5 Columbia Plateau
6 Upper Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AK AZ CA CO CT ID IL IN IA KS
KY LA ME MD MA MI MN MO MT NV
NH NJ NM NY NC ND OH OK OR PA
RI SC SD TN UT VT VA WA WV WI
WY DC


AB BC MB NB NF NT NS ON PE PQ
SK YT

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Black-capped Chickadee is confined to North America, ranging through most of Canada and the upper two-thirds of the United States.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Black-capped chickadees have short plump bodies, a solid black cap and bib, and white cheeks. They are a small bird weighing only 11 g and measuring 13.3 cm in length. Their wingspans measure 20.3 cm in flight. Their backs and wings are dark greenish-gray, with some streaks of white and black adorning the wing feathers. Their bellies are white with a light-reddish color on the flanks. They have small, pointed black beaks and dark legs. Male and female chickadees are identical.

Young black-capped chickadees resemble adults, but have brighter colors with more reddish coloration on the flanks.

Average mass: 11 g.

Average length: 13.3 cm.

Average wingspan: 20.3 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 10.4 g.

Average basal metabolic rate: 0.252 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The Black-capped Chickadee is easily recognized by its short plump body, solid black cap and bib, and white cheeks. Its back and wings are dark greenish-gray, with some streaks of white and black.

Average mass: 10.4 g.

Average basal metabolic rate: 0.252 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 13 cm

Weight: 11 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

The amount of white on the outer edge of the greater coverts is the best character for distinguishing Parus atricapillus and Carolinensis in the field, but birds in the contact zone may not be identified with certainty (Robbins 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black-capped chickadees prefer forests, woods and parks, cottonwood groves, and willow thickets. They are most commonly seen near edges of wooded areas. They are a frequent visitor to backyard bird feeders. Black-capped chickadees nest in cavities, usually in dead trees or stumps, and are attracted to habitats with suitable nesting locations. During the winter, small flocks of black-capped chickadees can be found in dense pine forests.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest

Other Habitat Features: suburban

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon and Schuster Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Requirements

More info for the terms: density, snag, softwood, tree

Nesting: Black-capped chickadees excavate holes in soft decayed wood
and also use existing cavities (but usually only if there is material to
be excavated) [30,31]. Dead standing trees greater than 4 inches (10
cm) dbh are used for nesting and feeding [6]. In Illinois nests were
found in cavities of stubs (broken off snags). The stubs were usually 5
to 6.6 feet (1.6-2 m) tall and 4.3 to 5.1 inches (11-13 cm) in diameter
[41].

Common nest sites are stubs of gray birch (Betula populifolia) or paper
birch (B. papyrifera) [12], but almost any early seral species with soft
wood may be used; the particular tree species favored depends on the
region. Most of these trees occur as living trees in early seral
stages, are short-lived, and persist into intermediate seral stages as
decaying snags [40]. For example, Odum [23] reported that of 18
black-capped chickadee nests he observed in upstate New York, 4 were in
pin cherry (Prunus pensylvanica), 3 in paper birch, 3 in American beech
(Fagus grandifolia), 2 in yellow birch (Betula alleghaniensis), 2 in
willows (Salix spp.), 1 in basswood (Tilia americana), 1 in sugar maple,
1 in white ash (Fraxinus americana), and 1 in an apple tree (Malus spp.)
[40]. In Vermont northern hardwoods forests, most black-capped
chickadee nest trees were in an advanced state of decay with soft outer
wood. Most nests were in trees that were shorter than neighboring
non-nest trees, but no smaller in diameter [26]. Nest trees used by
black-capped chickadees in northwestern Montana western larch (Larix
occidentalis)-Douglas-fir (Pseudotsuga menziesii) forests averaged 8
inches (20 cm) dbh and ranged from 4 to 12 inches (10-30.5 cm) dbh.
This was the smallest average diameter used by any of the cavity-nesting
birds observed [21]. Most nests were in broken-topped larch trees [20].
In Iowa 92 percent of black-capped chickadee nests in riparian
communities were in snags, 4 percent were in dead limbs of living trees,
and 4 percent were in living trees. There was a positive association
between black-capped chickadee use and snag size in snags less than 9
inches (25 cm) dbh [32]. In a riparian area in Colorado with a viable
black-capped chickadee population, snags are not plentiful but large
dead branches are. In an area dominated by plains cottonwood (Populus
deltoides var. occidentalis) with some peachleaf willow (S.
amygdaloides) and boxelder (Acer negundo), cottonwood snags comprised
2.7 percent of all cottonwood stems. This density of snags is quite
low, primarily due to the decadence of the stand. However, limb trees
(trees with more than 3.3 feet [1 m] of dead limbs greater than 4 inches
(10 cm) in diameter) made up 47 percent of the cottonwood population
[27].

In western Montana, McClelland and others [19] observed black-capped
chickadees using cavities excavated by sapsuckers (Sphyrapicus spp.)
[19]. Birdhouses are used occasionally [6].

Roosting: Black-capped chickadees roost primarily in thick vegetation
or in cavities, particularly on cold nights. Flocks seldom roost
clumped together, but flock members usually roost near each other [31].

Foraging and Feeding: Flock members usually feed from 3.3 to 33 feet
(1-10 m) apart, occasionally feeding within 2.5 inches (6 cm) for brief
periods [31].

Breeding Territory: Black-capped chickadee breeding territory size
varies with habitat quality, black-capped chickadee population density,
rank, and the course of the breeding season [30]. In upstate New York
breeding territories ranged in size from 8.4 acres (3.4 ha) to 17.1
acres (6.9 ha) and averaged 13.2 acres (5.3 ha) [23]. An eastern
Massachusetts population had an average breeding territory size of 10.7
acres (4.3 ha), but ranged from 3.8 to 17.9 acres (1.5-7.2 ha) [30].
  • 6. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 12. Headstrom, Richard. 1970. A complete field guide to nests in the United States, including those of birds, mammals, insects, fishes, reptiles, and amphibians. New York: I. Washburn. 451 p. [26015]
  • 19. McClelland, B. Riley. 1979. Cavity nesters: part of Montana's bird heritage. Montana Outdoors. 10(4): 34-37. [15176]
  • 20. McClelland, B. Riley; Frissell, Sidney S. 1975. Identifying forest snags useful for hole-nesting birds. Journal of Forestry. 73: 414-417. [15175]
  • 21. McClelland, B. Riley; Frissell, Sidney S.; Fischer, William C.; Halvorson, Curtis H. 1979. Habitat management for hole-nesting birds in forests of western larch and Douglas-fir. Journal of Forestry. August: 480-483. [9491]
  • 23. Odum, Eugene P. 1941. Annual cycle of the black-capped chickadee--1. Auk. 58: 314-333. [25037]
  • 26. Runde, Douglas E.; Capen, David E. 1987. Characteristics of northern hardwood trees used by cavity-nesting birds. Journal of Wildlife Management. 51(1): 217-223. [13743]
  • 27. Sedgwick, James A.; Knopf, Fritz L. 1986. Cavity-nesting birds and the cavity-tree resource in plains cottonwood bottomlands. Journal of Wildlife Management. 50(2): 247-252. [19447]
  • 30. Smith, Susan M. 1991. The black-capped chickadee: behavioral ecology and natural history. Ithaca, NY: Cornell Univ. Press. [Pages unknown]
  • 31. Smith, Susan M. 1993. Black-capped chickadee. In: Poole, A.; Stettenheim, P.; Gill, F., eds. The birds of North America. No. 39. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-20. [24337]
  • 32. Stauffer, Dean F.; Best, Louis B. 1980. Habitat selection by birds of riparian communities: evaluation effects of habitat alterations. Journal of Wildlife Management. 44(1): 1-15. [8118]
  • 40. Hardin, Kimberly I.; Evans, Keith E. 1977. Cavity nesting bird habitat in the oak-hickory forests--a review. Gen. Tech. Rep. NC-30. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 23 p. [13859]
  • 41. Brewer, Richard. 1961. Comparative notes on the life history of the Carolina chickadee. Wilson Bulletin. 73: 348-373. [25039]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: density, selection, tree, vine

Black-capped chickadees prefer relatively open sites near deep woods
[6]. They are usually more common near edges, but also occur in the
interior of wooded tracts [31]. In Iowa most observations of
black-capped chickadees were in floodplain woodlands and scrub; fewer
black-capped chickadees were observed in upland woodlands, wooded edges,
and savannah (in descending order of numbers of observations).
Black-capped chickadee observations were positively correlated with
sapling and tree species richness, sapling and tree size, and vertical
patchiness. There was a negative correlation with vine density and with
snag hardness [32]. In Saskatchewan black-capped chickadees were found
in aspen (Populus spp.) groves larger than 0.5 acre (0.2 ha) in area,
and did not occur in smaller groves [15]. In Montana foliage-insect
feeders including black-capped chickadees were observed most often in
uncut forests. Black-capped chickadees fed primarily where foliage
canopy was well developed above 26.4 feet (8 m) [24].

Riparian communities are important to black-capped chickadees and other
gleaners (birds which search vegetation for stationary prey). Emerging
aquatic insects are a particularly valuable food for gleaners. Mayflies
and stoneflies spend most of the daylight hours resting on low
vegetation near the stream channel. The density of gleaners (in this
area black-capped chickadees were the most abundant gleaners) is
positively correlated with emergence rates of aquatic insects [10].

In Colorado black-capped chickadee nest site selection was positively
associated with density of small trees; in Missouri and Tennessee,
black-capped chickadees are reported to prefer small trees and young
open forest [28].
  • 6. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 10. Gray, Lawrence. 1989. Correlations between insects and birds in tallgrass prairie riparian habitats. In: Bragg, Thomas B.; Stubbendieck, James, eds. Prairie pioneers: ecology, history and culture: Proceedings, 11th North American prairie conference; 1988 August 7-11; Lincoln, NE. Lincoln, NE: University of Nebraska: 263-265. [14060]
  • 15. Johns, Brian W. 1993. The influence of grove size on bird species richness in aspen parklands. Wilson Bulletin. 105(2): 256-264. [22269]
  • 24. Ramsden, David J.; Lyon, L. Jack; Halvorson, Gary L. 1979. Small bird populations and feeding habitats--western Montana in July. American Birds. 33(1): 11-16. [19316]
  • 28. Sedgwick, James A.; Knopf, Fritz L. 1990. Habitat relationships and nest site characteristics of cavity-nesting birds in cottonwood floodplains. Journal of Wildlife Management. 54(1): 112-124. [11105]
  • 31. Smith, Susan M. 1993. Black-capped chickadee. In: Poole, A.; Stettenheim, P.; Gill, F., eds. The birds of North America. No. 39. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-20. [24337]
  • 32. Stauffer, Dean F.; Best, Louis B. 1980. Habitat selection by birds of riparian communities: evaluation effects of habitat alterations. Journal of Wildlife Management. 44(1): 1-15. [8118]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

More info for the terms: presence, shrub, shrubs, tree

Black-capped chickadee habitat includes evergreen forested wetlands,
deciduous forested wetlands [35], deciduous woodlands, mixed woodlands,
deciduous and coniferous forests, orchards, deciduous shrubs, urban and
suburban areas [6], and disturbed areas such as old fields. Favored
riparian communities include cottonwood (Populus spp.) and sometimes
willow (Salix spp.) thickets. Birches (Betula spp.) and alders (Alnus
spp.) are often used for both food and nesting, but black-capped
chickadees use a wide variety of other plant species as well.
Black-capped chickadees occur in many habitat types [31].

In western North Dakota black-capped chickadees forage in the canopy and
nest in cavities in cottonwood stands; they occupy ash (mostly green ash
[Fraxinus pennsylvanica]) woodland interiors, and are found in pine
(Pinus spp.) communities. Black-capped chickadees are common in dense
ponderosa pine (P. ponderosa) stands with well-developed shrub layers [14].

In the Konza Prairie, Kansas, black-capped chickadees were the second
most abundant species in gallery forests. These forests are dominated
by bur oak (Quercus macrocarpa), chinkapin oak (Q. muehlenbergii), and
hackberry (Celtis occidentalis) [8]. Black-capped chickadees also occur
on adjacent prairie dominated by big bluestem (Andropogon gerardii),
little bluestem (Schizachyrium scoparium), switchgrass (Panicum
virgatum), and indiangrass (Sorghastrum nutans). The presence of
black-capped chickadees in grassland habitat was attributed to the
availability of isolated tree and shrub patches along ravines [8].

In Illinois black-capped chickadees were recorded in northern red oak
(Q. rubra)-sugar maple (Acer saccharum)-hackberry dominated woodlands [35].
  • 6. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 8. Finck, Elmer J. 1986. Birds wintering on the Konza Prairie Research Natural Area. In: Clambey, Gary K.; Pemble, Richard H., eds. The prairie: past, present and future: Proceedings, 9th North American prairie conference; 1984 July 29 - August 1; Moorhead, MN. Fargo, ND: Tri-College University Center for Environmental Studies: 91-94. [3535]
  • 14. Hopkins, Rick B.; Cassel, J. Frank; Bjugstad, Ardell J. 1986. Relationships between breeding birds and vegetation in four woodland types of the Little Missouri National Grasslands. Res. Pap. RM-270. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 12 p. [2758]
  • 31. Smith, Susan M. 1993. Black-capped chickadee. In: Poole, A.; Stettenheim, P.; Gill, F., eds. The birds of North America. No. 39. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-20. [24337]
  • 35. Willson, Mary F. 1974. Avian community organization and habitat structure. Ecology. 55: 1017-1029. [19306]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

109 Ponderosa pine shrubland
110 Ponderosa pine-grassland
412 Juniper-pinyon woodland
422 Riparian

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

1 Jack pine
5 Balsam fir
12 Black spruce
13 Black spruce-tamarack
14 Northern pin oak
15 Red pine
16 Aspen
17 Pin cherry
18 Paper birch
19 Gray birch-red maple
20 White pine-northern red oak-red maple
21 Eastern white pine
22 White pine-hemlock
23 Eastern hemlock
24 Hemlock-yellow birch
25 Sugar maple-beech-yellow birch
26 Sugar maple-basswood
27 Sugar maple
28 Black cherry-maple
30 Red spruce-yellow birch
31 Red spruce-sugar maple-beech
32 Red spruce
33 Red spruce-balsam fir
34 Red spruce-Fraser fir
35 Paper birch-red spruce-balsam fir
37 Northern white-cedar
38 Tamarack
39 Black ash-American elm-red maple
40 Post oak-blackjack oak
42 Bur oak
43 Bear oak
44 Chestnut oak
46 Eastern redcedar
50 Black locust
51 White pine-chestnut oak
52 White oak-black oak-northern red oak
53 White oak
55 Northern red oak
57 Yellow-poplar
58 Yellow-poplar-eastern hemlock
59 Yellow-poplar-white oak-northern red oak
60 Beech-sugar maple
62 Silver maple-American elm
63 Cottonwood
87 Sweetgum-yellow-poplar
93 Sugarberry-American elm-green ash
94 Sycamore-sweetgum-American elm
95 Black willow
107 White spruce
108 Red maple
109 Hawthorn
110 Black oak
201 White spruce
202 White spruce-paper birch
204 Black spruce
205 Mountain hemlock
206 Engelmann spruce-subalpine fir
210 Interior Douglas-fir
208 Whitebark pine
210 Interior Douglas-fir
211 White fir
212 Western larch
213 Grand fir
215 Western white pine
216 Blue spruce
218 Lodgepole pine
219 Limber pine
223 Sitka spruce
224 Western hemlock
225 Western hemlock-Sitka spruce
227 Western redcedar-western hemlock
228 Western redcedar
229 Pacific Douglas-fir
230 Douglas-fir-western hemlock
234 Douglas-fir-tanoak-Pacific madrone
237 Interior ponderosa pine
238 Western juniper
244 Pacific ponderosa pine-Douglas-fir
245 Pacific ponderosa pine
251 White spruce-aspen
253 Black spruce-white spruce
254 Black spruce-paper birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the terms: bog, shrub

K001 Spruce-cedar-hemlock forest
K002 Cedar-hemlock-Douglas-fir forest
K003 Silver fir-Douglas-fir forest
K004 Fir-hemlock forest
K005 Mixed conifer forest
K008 Lodgepole pine-subalpine forest
K010 Ponderosa shrub forest
K011 Western ponderosa forest
K012 Douglas-fir forest
K013 Cedar-hemlock-pine forest
K014 Grand fir-Douglas-fir forest
K015 Western spruce-fir forest
K016 Eastern ponderosa forest
K017 Black Hills pine forest
K018 Pine-Douglas-fir forest
K019 Arizona pine forest
K020 Spruce-fir-Douglas-fir forest
K021 Southwestern spruce-fir forest
K022 Great Basin pine forest
K028 Mosaic of K002 and K026
K029 California mixed evergreen forest
K081 Oak savanna
K082 Mosaic of K074 and K100
K093 Great Lakes spruce-fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K096 Northeastern spruce-fir forest
K097 Southeastern spruce-fir forest
K098 Northern floodplain forest
K099 Maple-basswood forest
K100 Oak-hickory forest
K101 Elm-ash forest
K109 Transition between K104 and K106

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES15 Oak-hickory
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black-capped chickadees prefer deciduous woodlands, open woods and parks, cottonwood groves, and willow thickets. They are most commonly seen near edges of wooded areas.

Terrestrial Biomes: taiga ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Black-capped chickadees inhabit deciduous and mixed deciduous/coniferous forest and woodland, willow thickets, cottonwood groves, old fields, and wooded suburban areas. Nests are in cavities dug by both sexes in trees, especially dead trees or rotten branches, sometimes in existing natural cavities, old woodpecker holes, bird boxes, or similar sites (Grubb and Bronson 1995, Condor 97:1067-1070).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Black-capped chickadees feed on both animals and plants (the overall consumption has been measured to be about 70% animal and 30% plant). Animal foods consist mainly of insects and spiders. Caterpillars are preferred in the breeding season. Chickadees have been observed eating dead deer, skunks and fish. Plant materials eaten by chickadees include honeysuckle and blackberries, seeds from hemlocks, and wax-covered berries such as those of poison ivy and bayberry. They are often seed at backyard bird feeders, eating seed and suet. Black-capped chickadees obtain water from streams, puddles, bird baths, or by eating snow.

Animal Foods: carrion ; insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

More info for the terms: scatter-hoard, tree

Foraging: Black-capped chickadees forage from ground to treetop; ground
foraging birds have usually been displaced by higher ranking birds [30].
Black-capped chickadees forage on tree trunks, branches, and foliage
[11], feeding on insects [34], seeds, and berries. Five basic foraging
maneuvers used by black-capped chickadees are 1) gleaning (57% of time
spent foraging), 2) hanging from leaf or twig to capture food items
(28%), 3) hovering (8.8%), 4) probing (3.5%), and 5) catching insects in
flight, called hawking (2.4%). These proportions probably vary with
availability of prey, season, and other factors [31].

Caching: Black-capped chickadees cache seeds from open cones [11].
Insects are also cached. Most caching occurs in the fall, but caching
may occur at any time food is plentiful. Storage sites include bark,
dead leaves, clusters of conifer needles, dirt, and snow. Black-capped
chickadees scatter-hoard; they hide each individual food item in a
separate spot [31]. Sherry [29] reported that black-capped chickadees
can remember cache sites for at least 24 hours, and Hitchcock and Sherry
[13] reported that captive black-capped chickadees can recover caches
after 28 days.

Animal Foods: In winter, approximately 50 percent of black-capped
chickadee foods are animal foods, the rest seeds and berries. During
the breeding season, 80 to 90 percent of the black-capped chickadee diet
is animal foods [18,31]. Winter black-capped chickadee animal foods
consist mostly of eggs of moths, plant lice, katydids, and spiders. In
summer moths, caterpillars, spiders, beetles (particularly weevils),
flies, wasps, true bugs, plant lice, scale insects, leafhoppers, and
tree hoppers are common food items [18]. Smith [30] described the
black-capped chickadee summer diet as consisting largely of
caterpillars, including some hairy caterpillars such as early instar
gypsy moths and tent caterpillars. Black-capped chickadees have been
observed taking animal fat from carrion and eating suet and peanut butter
at feeders [30].

Plant Foods: Black-capped chickadee plant foods are mainly seeds and
berries including goldenrods (Solidago spp.) and staghorn sumac (Rhus
typhina) seeds in fall. Pine seeds are a main staple in fall, winter,
and spring. Seeds of hemlocks (Tsuga spp.) and birches are eaten in
winter; seeds or fruits of poison-ivies (Toxicodendron spp.),
blueberries and huckleberries (Vaccinium spp.), bayberries (Myrica
spp.), ragweeds (Ambrosia spp.), sunflowers (Helianthus spp.),
chokecherry (Prunus virginiana), and Virginia creeper (Parthenocissus
quinquefolia) are eaten in spring and summer [18]. Raspberries (Rubus
spp.), cherries (Prunus spp.), and yellow-poplar (Liriodendron
tulipifera) seeds are also consumed [30].

Fluids: Black-capped chickadees drink when water is available. Fluids
are derived mostly from foods in winter; highest demand for liquid water
is in summer [31].
  • 11. Halvorson, Curtis H. 1986. Influence of vertebrates on conifer seed production. In: Shearer, Raymond C., compiler. Proceedings--conifer tree seed in the Inland Mountain West symposium; 1985 August 5-6; Missoula, MT. Gen. Tech. Rep. INT-203. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 201-222. [13115]
  • 13. Hitchcock, Christine L.; Sherry, David F. 1990. Long-term memory for cache sites in the black-capped chickadee. Animal Behavior. 40: 701-712. [25114]
  • 18. Martin, Alexander C.; Zim, Herbert S.; Nelson, Arnold L. 1951. American wildlife and plants. New York: McGraw-Hill Book Company, Inc. 500 p. [4021]
  • 29. Sherry, David. 1984. Food storage by black-capped chickadees: memory for the location and contents of caches. Animal Behavior. 32: 451-464. [25113]
  • 30. Smith, Susan M. 1991. The black-capped chickadee: behavioral ecology and natural history. Ithaca, NY: Cornell Univ. Press. [Pages unknown]
  • 31. Smith, Susan M. 1993. Black-capped chickadee. In: Poole, A.; Stettenheim, P.; Gill, F., eds. The birds of North America. No. 39. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-20. [24337]
  • 34. Udardy, Miklos D. F. 1969. Birds of the coniferous forest. In: Taber, Richard D., ed. Coniferous forests of the northern Rocky Mountains: Proceedings of the 1968 symposium; 1968 September 17-20; Missoula, MT. Missoula, MT: University of Montana Foundation, Center for Natural Resources: 99-129. [7542]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Black-capped chickadees feed on both animals and plants (the overall consumption has been measured to be about 70% animal and 30% plant). Animal foods consist mainly of insects and spiders. Caterpillars are preferred in the breeding season. Chickadees have been observed eating deer or skunk fat and fish. Plant materials eaten by the chickadee include honeysuckle and blackberries, seeds from hemlocks, and wax-covered berries such as those of poison ivy and bayberry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly insects and other small invertebrates, and their eggs and immature stages, and seeds and fruits; forages mainly on woody twigs, branches, and stems (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As a cavity nesting species that excavates new nests each season, black-capped chickadees create habitat for other local species that rely on cavities. Many species that nest in cavities do not have the ability to create cavities themselves and are only able to breed where others have abandoned a nest. Black-capped chickadees occasionally eat seeds and berries and likely contribute to local seed distribution.

Ecosystem Impact: disperses seeds; creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Black-capped chickadees give sharp "zeet" alarm calls when they see a predator. Predators are often mobbed by groups of chickadees in order to scare it away. Predators near nests often evoke a distraction display, where the chickadee lands near the predator, leans towards it with the tail feathers fully spread, and raises and lowers its wings.

Adult black-capped chickadees are preyed on primarily by small hawks, owls, and shrikes, including Accipiter striatus, Lanius excubitor, Otus asio, and Aegolius acadicus. Eggs and nestlings are preyed on by mammalian nest predators such as Procyon lotor, squirrels (genera Sciurus and Tamiasciurus), Didelphis virginianus, and Mustela. Troglodytes aedon sometimes destroy eggs in order to take over the nesting cavity.

Known Predators:

  • Sharp-shinned hawks (Accipiter_striatus)
  • Northern shrikes (Lanius_excubitor)
  • Eastern screech owls (Otus_asio)
  • Saw whet owls (Aegolius_acadicus)
  • Raccoons (Procyon_lotor)
  • Tree squirrels (Sciurus)
  • Red squirrels (Tamiasciurus)
  • Opossums (Didelphis_virginianus)
  • Weasels (Mustela)
  • House wrens (Troglodytes_aedon)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predators

Natural predators of the black-capped chickadee include goshawk
(Accipiter gentilis), sharp-shinned hawk (A. striatus), Cooper's hawk
(A. cooperii), American kestrel (Falco sparverius), merlin (F.
columbarius), northern pygmy-owl (Glaucidium gnoma), and northern shrike
(Lanius excubiter). Around birdfeeders, the black-capped chickadee is
often preyed on by the domestic cat (Felis catus). Nest predators are
largely excluded by the small size of black-capped chickadee nest
entrance holes, but very small squirrels (Tamiascurius spp.) or
chipmunks (Tamias spp.) occasionally raid black-capped chickadee nests.
Weasels (Mustela spp.) and climbing snakes pose a threat to eggs and
nestlings [30].
  • 30. Smith, Susan M. 1991. The black-capped chickadee: behavioral ecology and natural history. Ithaca, NY: Cornell Univ. Press. [Pages unknown]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Black-capped chickadees give sharp "zeet" alarm calls when they see a predator. Predators are often mobbed by groups of chickadees in order to scare it away. Predators near nests often evoke a distraction display, where the chickadee lands near the predator, leans towards it with the tail feathers fully spread, and raises and lowers its wings.

Adult black-capped chickadees are preyed on primarily by small hawks, owls, and shrikes, including sharp-shinned hawks (Accipiter striatus), northern shrikes (Lanius excubitor), eastern screech owls (Otus asio), and saw whet owls (Aegolius acadicus). Eggs and nestlings are preyed on by mammalian nest predators such as raccoons (Procyon lotor), squirrels (Sciurus and Tamiasciurus), opossums (Didelphis virginianus), and weasels (Mustela). House wrens (Troglodytes aedon) sometimes destroy eggs in order to take over the nesting cavity.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Poecile atricapillus (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) is prey of:
Accipiter striatus
Accipiter cooperii
Bubo virginianus

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Poecile atricapillus (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) preys on:
Araneae
Insecta

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: density, snag, wildfire

The most likely change due to fire in black-capped chickadee habitat is
with respect to snag density (nest site availability) and food
availability. Niemi [22] suggested that chickadee populations generally
decrease following fire, probably due to a decrease in habitat
complexity and available food.

In northern Rocky Mountain conifer forests that were severely burned
within 1 to 2 years of the study, black-capped chickadees were detected
on 13 of 33 sites. In a survey of bird habitat studies in northern
Rocky Mountain dryland habitats, segregated by habitat type,
black-capped chickadees were found on early successional (less than 10
years old) burned forest (48% of 23 studies), and mid-successional (10
to 40 years old) burned forest (40% of 5 studies). Studies reporting
observations of birds in cottonwood bottomlands had the highest
proportion of black-capped chickadee observations (64% of 21 studies).
Black-capped chickadees had a habitat preference average of 9.71 out of
15 possible habitats (if this figure were 1, a bird species is
restricted to only 1 of the 15 habitats, if the figure were 15, the
species has shown absolutely no preference for any of the available
habitat types) [39].

In northern Minnesota the Little Sioux fire burned 15,000 acres (6,072
ha) of northern hardwoods and pine forests. Black-capped chickadees
were common on unburned stands, but in postfire years 2, 3, and 4 they
were uncommon on all burned study sites [22].

In north-central Colorado a severe 1966 wildfire in lodgepole pine
(Pinus contorta) with subalpine fir (Abies lasiocarpa) and Engelmann
spruce (Picea engelmannii) resulted in widespread crown mortality. In
1974 there were many standing dead trees on the burned site. There were
no black-capped chickadees observed on the burned site, but there were a
few in the ecotone and in adjacent unburned lodgepole stands [25].
  • 22. Niemi, Gerald J. 1978. Breeding birds of burned and unburned areas in northern Minnesota. Loon. 50: 73-84. [14451]
  • 25. Roppe, Jerry A.; Hein, Dale. 1978. Effects of fire on wildlife in a lodgepole pine forest. Southwestern Naturalist. 23(2): 279-287. [261]
  • 39. Hutto, Richard L. [In press]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: altricial, formation, torpor

Pair Formation: The peak period for pair formation is fall and is
associated with winter flock formation; winter flocks consist largely of
mated pairs. Even very young black-capped chickadees form pair bonds at
this time. A few pairs are formed in winter following mortality of
high-ranking members of the flock, and occasionally floaters
(low-ranking individuals unattached to a mate or a flock) establish new
pair bonds in spring [30,31].

Territory Establishment: Territories are established in spring, during
winter flock break-up; this period varies with area, year, and other
factors. Breeding territory boundaries are usually established 5 to 7
weeks before onset of egg-laying [30,31].

Nesting: Both the male and female excavate the nest hole, but the
female builds the nest. The cup-shaped nest consists of cottony plant
fibers, hairs, wool, moss, and leaves, and is lined with hair, plant
down, wool, and feathers [12].

Clutch: Eggs are laid from early April to mid-July depending on spring
weather and food availability [30]. Usually 1 egg is laid per day; the
average clutch size is from 6 to 8 eggs, ranging from 5 to 10. Eggs are
incubated for 12 to 13 days by the female, who is fed by the male [38].
All eggs usually hatch within 12 to 30 hours of each other, usually in
the order laid [31]; nestlings are present from early May to late July
[30,31].

Development of Young: Black-capped chickadees are altricial; newly
hatched young are blind and nearly naked. They have pinfeathers by
about day 9, and usually fledge on day 16. When nests are disturbed,
fledglings may leave the nest early, sometimes as early as 12 days.
Fledglings are fed by the parents for 2 to 4 weeks (3-4 weeks is
typical) [30,31].

Longevity: Age at first breeding is typically less than 1 year,
although some individuals may not breed until they are 1 or 2 years old.
The average lifespan of black-capped chickadees is approximately 2.5
years; however, 5-year-old birds were not uncommon in northwestern
Connecticut [17]. The longest lived black-capped chickadee on record
was at least 12 years 5 months at the time of last banding [31].

Mortality: Black-capped chickadees are fairly cold hardy; the majority
of black-capped chickadee mortality is believed to be caused by winter
malnutrition, which reduces the ability to withstand cold weather and
resist disease. There have been few major outbreaks of diseases in
black-capped chickadee populations and there are relatively few nest
parasites [31].

Wintering: Wintering flocks of black-capped chickadees usually consist
of four to eight individuals [9]. Black-capped chickadee residence in
cold climates is made possible by night torpor, a regulated hypothermia
which allows black-capped chickadees to survive cold nights with minimum
energy loss [31].

Seasonal Movements: Long-distance movements are usually only undertaken
by black-capped chickadees less than 1 year old. However, large numbers
of black-capped chickadees emigrate at irregular intervals of about 2
years. These movements are more properly termed irruptions than
seasonal migrations. Factors influencing irruptions, particularly in
the eastern portions of the black-capped chickadee range, include
fluctuation in northern seed crops and unusually high recruitment rates.
Fall movements tend to be south or southwest; spring movements are
usually northward but are sometimes aimless [31]. Movement over water
is avoided or undertaken only with great hesitation [30,38].
  • 9. Ficken, Millicent S. 1981. Food finding in black-capped chickadees: altruistic communication?. Wilson Bulletin. 93(3): 393-394. [25038]
  • 12. Headstrom, Richard. 1970. A complete field guide to nests in the United States, including those of birds, mammals, insects, fishes, reptiles, and amphibians. New York: I. Washburn. 451 p. [26015]
  • 17. Loery, Gordon; Nichols, James D. 1985. Dynamics of a black-capped chickadee population, 1958-1983. Ecology. 66(4): 1195-1203. [24338]
  • 30. Smith, Susan M. 1991. The black-capped chickadee: behavioral ecology and natural history. Ithaca, NY: Cornell Univ. Press. [Pages unknown]
  • 31. Smith, Susan M. 1993. Black-capped chickadee. In: Poole, A.; Stettenheim, P.; Gill, F., eds. The birds of North America. No. 39. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-20. [24337]
  • 38. Bent, Arthur Cleveland. 1964. Life histories of North American thrushes, kinglets, and their allies. New York: Dover Publications, Inc. 452 p. [24782]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Massachusetts, once they became breeders, males lived an average of 3.2 years, females lived an average of 2.5 years (Smith 1995, Auk 112:840-846). In Alberta, winter survival rates were higher in a food-supplemented area than in a control area, but breeding densities in the two areas were similar (Desrochers et al. 1988). In Pennsylvania, supplemental food appeared to influence movements more so than it did winter survival, but in Wisconsin there was evidence that bird feeders influenced actual survival rates (Egan and Brittingham 1994).

In southwestern Alberta, territory size averaged about 8-9 ha, overlapped with territories of mountain chickadee (Hill and Lein 1989).

In cold winter weather, black-capped chickadees may undergo regulated hypothermia, which saves them significant amounts of energy. They also store food and may roose communally in tree cavities, thus minimizing heat loss.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Black-capped chickadees are well known for their distinctive calls which sound like "chick-a-dee-dee-dee." This is not the only sound they make, however, as adults can produce 16 different calls. Young chickadees can produce 3 types of calls which are used for begging for food or if they are in distress. Males use a two-note "fee-bee" call to establish territory and attract mates. Chickadees also make an angry "gargle" call when intruders enter their territory.

Black-capped chickadees also communicate through body postures or movements. These body postures are known to convey aggression or appeasement. Aggressive behaviors include ruffling the body or crown feathers, hopping and pivoting behavior between two individuals, or an open-mouthed advance by one chickadee on another. Subordinate individuals will often try to appease an approaching dominant individual by holding their feathers tightly to their bodies while leaning and facing away from the dominant bird. Male and female black-capped chickadees perform a distraction display where a bird will flare it's tail feathers and wings to lure predators away from the nest.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There has been little formal study regarding the lifespan of black-capped chickadees. It is estimated that they live an average of 2.5 years with the oldest on record being 12.5 years old.

Average lifespan

Status: wild:
12.5 years.

Average lifespan

Status: wild:
2.5 years.

Average lifespan

Status: wild:
149 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Black-capped chickadees have been recorded living up to 11 years and 2 months in the wild.

Average lifespan

Status: wild:
149 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.4 years (wild) Observations: In the wild, the average longevity is 2.5 years. Record longevity in the wild is 12.4 years (http://www.fs.fed.us/database/feis/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Black-capped chickadees form pairs of one male and one female. They stay with each other to mate and raise chicks, but they may find different partners from year to year. Pairs are formed during the fall migration. Males show interest in females by chasing them in flight. Males will select females of equal rank so that the highest ranking male will mate with the highest ranking female.

Mating System: monogamous

Both males and females participate in excavating a nest in a dead tree or rotting stump. Black-capped chickadees prefer a nesting tree if the inner wood is soft, but the outer wood is sturdy. Pairs will often excavate several nest cavities before the female selects one to begin building a nest in. The cavity is lined with moss, feathers, wood shavings, and animal hair. Nest cavities are rarely re-used in later years. The breeding season begins in early spring, and the eggs are laid between April and early July. The female begins laying eggs 1 to 2 days after completing the nest, with a typical clutch consisting of 6 to 8 eggs. Females are the only incubators and this incubation period lasts 12 to 13 days. While the female stays in the nest and warms the eggs, the male brings food for her. The young are altricial at birth, meaning they have only a few feathers and their eyes are closed. They depend on their parents for food and warmth. The chicks are very small and only weigh 1 g when they hatch. The chicks are fed and kept warm until they fledge (able to fly and leave the nest) at 14 to 18 days old. The parents and fledgelings then leave the nest site, but travel in a group and the parents continue to feed the young until they reach independence at 5 to 6 weeks of age.

Breeding interval: Black-capped chickadees breed once yearly.

Breeding season: Black-capped chickadees breed from April to early August.

Range eggs per season: 5 to 10.

Average eggs per season: 6 to 8.

Range time to hatching: 12 to 13 days.

Range fledging age: 14 to 18 days.

Range time to independence: 5 to 6 weeks.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 7.

Average age at sexual or reproductive maturity (male)

Sex: male:
180 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
180 days.

In black-capped chickadees, both males and females participate in excavating a cavity nest. They will excavate several cavities and the female will select one to construct a nest. The female builds the nest alone and fills the cavity with moss, feathers, wood chips and animal fur. During this time, the male will protect the surrounding territory by distracting any predators and leading them away from the nest. The female performs all egg incubation and the male will feed her. Once the chicks have hatched, the male continues his feeding duties and will provide food for the female and the chicks. Black-capped chickadees are born altricial and require significant parental investments to feed and brood the young until they can see, thermoregulate, and feed on their own. The female will leave the nest after the young develop feathers, and she will participate in gathering food for the growing chicks. After chicks have fledged, the family will leave the nest site and travel together until the young reach independence. Both the male and female participate in feeding the young until independence.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pair formation occurs in the fall, with eggs being laid some time between April and early July (depending on the geographic location). The female builds the nest alone, as well as incubating the eggs exclusively. The eggs are left unattended for short periods (about 7 minutes). The male brings food to the female.

Average time to hatching: 12 days.

Average eggs per season: 7.

Average age at sexual or reproductive maturity (male)

Sex: male:
180 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
180 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nesting phenology varies geographically. Examples of known egg dates include: late April to mid-June in Illinois; early May to mid-July in Massachusetts; late May to early June in Nova Scotia; mid-April to late June in Oregon; and mid-April to early July in Michigan. Clutch size is 5-10 (usually 6-8). Incubation lasts usually 12-13 days. Young are tended by both parents, fledge 12-16 days after hatching. Initially fledglings are fed by their parents, disperse usually 3-4 weeks after fledging. Pairbond may persist over several years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Poecile atricapillus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 35 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTCTACCTAATCTTCGGCGCATGAGCCGGAATGGTAGGAACCGCCCTAAGCCTCCTCATCCGTGCAGAACTGGGCCAACCCGGCGCTCTCCTGGGGGACGACCAGATCTATAACGTAGTCGTTACAGCCCATGCCTTCGTAATAATCTTCTTCATGGTCATGCCAATTATAATCGGAGGATTTGGAAACTGACTAGTTCCCCTAATAATTGGAGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTACCCCCCTCCTTCCTACTTCTGCTAGCCTCCTCTACAGTGGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCCCTGGCCGGCAACCTAGCCCACGCCGGAGCATCAGTAGACCTAGCCATCTTCTCCCTACACCTGGCAGGTATCTCATCAATCCTGGGGGCAATCAACTTCATCACAACCGCAATCAACATGAAACCACCTGCCCTCTCACAATACCAAACTCCCCTGTTCGTCTGATCCGTACTAATTACTGCAGTTCTCCTCCTACTCTCACTCCCAGTCCTTGCCGCTGGTATCACCATGCTCCTCACCGACCGTAACCTCAACACCACCTTCTTCGACCCTGGAGGAGGAGGGGACCCGGNGNTNTACAAACACCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATCCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Poecile atricapillus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 35
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Parus atricapillus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGCCTCCTCATCCGTGCAGAACTGGGCCAACCCGGCGCTCTCCTGGGGGAC---GACCAGATCTATAACGTAGTCGTTACAGCCCATGCCTTCGTAATAATCTTCTTCATGGTCATGCCAATTATAATCGGAGGATTTGGAAACTGACTAGTTCCCCTAATA---ATTGGAGCCCCTGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTACCCCCCTCCTTCCTACTTCTGCTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCCCTAGCCGGCAACCTAGCCCACGCCGGAGCATCAGTAGACCTA---GCCATCTTCTCCCTACACCTGGCAGGTATCTCATCAATCCTGGGGGCAATCAACTTCATCACAACCGCAATCAACATGAAACCACCTGCCCTCTCACAATACCAAACTCCCCTGTTCGTCTGATCCGTACTAATCACTGCAGTTCTCCTCCTACTCTCACTCCCAGTCCTTGCCGCT---GGTATCACCATGCTCCTCACCGACCGTAACCTCAACACCACCTTCTTCGACCCTGCAGGAGGAGGGGACCCGGTGCTCTACCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Parus atricapillus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

While the clearing of forests for agriculture has led to more forest edge, which is favorable to black-capped chickadees, too much cutting can cause lack of natural nest sites. Due to feeders and nestboxes, however, black-capped chickadee populations are stable. Black-capped chickadees perform short-distance migrations and therefore are protected by the United States Migratory Bird Act. Black-capped chickadees are abundant throughout Michigan.

IUCN Red List of Threatened Species: no special status

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

While the clearing of forests for agriculture has led to more forest edge, which is favorable to black-capped chickadees, too much cutting can cause lack of natural nest sites. Due to feeders and nestboxes, however, the black-capped chickadee has little current threat to its population.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Considerations

More info for the term: shrubs

A review of Christmas Bird Count data for the Pacific Northwest showed
that most black-capped chickadee populations have apparently been stable
during the past 40 years. Of 49 locales reporting, 6 showed significant
declines (stations in Alaska, British Columbia, Montana, and Oregon), 5
showed significant increases (British Columbia, California, Montana, and
Washington), and the remaining 38 showed no overall change. It was
speculated that the "significant" increases and decreases may actually
represent anomalous data [4].

Long-term wildlife management should strive for sites with a mosaic of
age structures [28]. In northwestern Connecticut the clearcutting of 60
acres (24.4 ha) of red pine (Pinus resinosa) within a 321 acre (130 ha)
banding plot had no discernible effect on black-capped chickadee
populations in a long-term population study [17].

Forest clearing can increase edge, which is preferred (but not required)
black-capped chickadee habitat. Removal of snags and cull trees with
dead limbs decreases available nest sites for black-capped chickadees
[31,32], although black-capped chickadees are listed as tolerant of
habitat alteration [32].

Stauffer and Best [32] listed the following predicted effects of various
types of habitat alteration on black-capped chickadee populations:

removal of all wood vegetation: elimination
reduce woody vegetation to narrow strips: negative
woody canopy partly removed: no effect
woody canopy partly removed, shrubs and saplings thinned: negative
shrubs and saplings thinned: negative
snags removed: negative

Lack of cottonwood regeneration is detrimental to the long-term
stability of cavity-nesting bird populations [17].

In cold-winter areas, feeders often enhance black-capped chickadee
survival, particularly in disturbed areas where food supplies are
limited [31]. Nest boxes can increase available nest sites where
natural cavities are limited. Nest boxes are not readily used unless
they are half-filled with sawdust, apparently so that the birds have
something to excavate [30].

Black-capped chickadees are only rarely host to the brown-headed cowbird
(Molothrus ater) [31].

Black-capped chickadees are important predators of larch casebearer
larvae and pine sawfly larvae [5].
  • 4. Brennan, Leonard A.; Morrison, Michael L. 1991. Long-term trends of chickadee populations in western North America. Condor. 93: 130-137. [24339]
  • 17. Loery, Gordon; Nichols, James D. 1985. Dynamics of a black-capped chickadee population, 1958-1983. Ecology. 66(4): 1195-1203. [24338]
  • 28. Sedgwick, James A.; Knopf, Fritz L. 1990. Habitat relationships and nest site characteristics of cavity-nesting birds in cottonwood floodplains. Journal of Wildlife Management. 54(1): 112-124. [11105]
  • 30. Smith, Susan M. 1991. The black-capped chickadee: behavioral ecology and natural history. Ithaca, NY: Cornell Univ. Press. [Pages unknown]
  • 31. Smith, Susan M. 1993. Black-capped chickadee. In: Poole, A.; Stettenheim, P.; Gill, F., eds. The birds of North America. No. 39. Philadelphia: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-20. [24337]
  • 32. Stauffer, Dean F.; Best, Louis B. 1980. Habitat selection by birds of riparian communities: evaluation effects of habitat alterations. Journal of Wildlife Management. 44(1): 1-15. [8118]
  • 5. Coppel, Harry C.; Sloan, Norman F. 1971. Avian predation, an important adjunct in the suppression of larch casebearer and introduced pine sawfly populations in Wisconsin forests. In: Proceedings: Tall Timbers conference on ecological animal control by Habitat management; 1970 February 26-28; Tallahassee, FL. No. 2. Tallahassee, FL: Tall Timbers Research Station: 259-272. [19332]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative effects of black-capped chickadees on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Black-capped chickadees help control populations of insect species that may be harmful to agriculture and forestry. Many bird watchers enjoy black-capped chickadees as they are comical, active little birds that often visit backyard feeders.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Black-capped chickadees help control populations of insect species that may be harmful to agriculture and silviculture.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black-capped Chickadee

The Black-capped Chickadee (Poecile atricapillus) is a small, nonmigratory, North American songbird that lives in deciduous and mixed forests. It is a passerine bird in the tit family Paridae. It is the state bird of both Maine and Massachusetts in the United States, and the provincial bird of New Brunswick in Canada. It is notable for its capacity to lower its body temperature during cold winter nights, its good spatial memory to relocate the caches where it stores food, and its boldness near humans (they can feed from the hand).

Taxonomy[edit]

Though often placed in the genus Parus with most other tits, mtDNA cytochrome b sequence data and morphology suggest that separating Poecile more adequately expresses these birds' relationships.[2] The American Ornithologists' Union has treated Poecile as a distinct genus for some time.

The genus name Poecile has often been treated as feminine (giving the species name ending atricapilla); however, this was not specified by the original genus author Johann Jakob Kaup, and under the ICZN, the genus name must therefore be treated by default as masculine, giving the name ending atricapillus.[3]

At one time the Black-Capped Chickadee was considered by some to be conspecific with the Willow Tit of Eurasia, due to their very similar appearance. This is reflected in an older version of the Peterson Field Guide for the Birds of Britain and Europe, which states "N Am. Black-Capped Chickadee" as an alternate name for the Willow Tit. In fact, despite their similar appearance, the Willow Tit, Black-Capped Chickadee, Marsh Tit and Carolina Chickadee are all separate species.

Description[edit]

Black-capped Chickadee clinging to a wire.

The Black-capped Chickadee has a black cap and bib with white sides to the face. Its underparts are white with rusty brown on the flanks. Its back is gray and the tail is normally slate-gray. This bird has a short dark bill of 8–9.5 mm (0.31–0.37 in), short rounded wings 63.5–67.5 mm (2.50–2.66 in), a tarsus of 16–17 mm (0.63–0.67 in) and a long tail at 58–63 mm (2.3–2.5 in).[4] Total body length is 12–15 cm (4.7–5.9 in), wingspan is 16–21 cm (6.3–8.3 in) and body mass is 9–14 g (0.32–0.49 oz).[5] Sexes look alike, but males are slightly larger and longer than females.

Although range can generally be used to separate them, the Black-capped Chickadee is very similar in appearance to the Carolina Chickadee. The Black-capped is larger on average but this cannot be used reliably for identification. The most obvious difference between the two is in the wing feathers. In the Black-capped Chickadee, the wing feathers have white edges that are larger and more conspicuous than those of the Carolina Chickadee. The latter is often mistaken for Black-capped Chickadees with feather dystrophy which sometimes affects the appearance of the primary feathers making them look slimmer, a phenomenon caused by illnesses such as fatty liver disease in malnourished birds. Overall, the Carolina appears slightly paler colored whereas the flanks of the Black-capped can appear to have a trace of off-yellow or rusty coloration. Also, the Black-capped generally has a more "ragged" looking black bib, whereas the bib of the Carolina has a more smooth-edged look. These subtle features are often even more vague in populations around where the Black-capped and Carolina overlap in range (possibly the result of hybrids) and the two cannot always be distinguished as two species. The two species were formerly thought to be easily distinguished by call, but they often learn each other's vocalizations where their ranges overlap (their point of overlap is a narrow band that runs along the east-central United States, with the Black-capped Chickadee to the north). A bird located near the zone of overlap that sings both songs, or sings "odd-sounding" songs, cannot be positively identified solely by voice in the field.[6]

Distribution and habitat[edit]

The black-capped chickadee is found from coast to coast, from the northern half of the United States in the south, to James Bay, the southern edge of the Northwest Territories and the Yukon, and the southern half of Alaska in the north. In winter it may wander outside this range, both to the north and south.

Its preferred habitat is deciduous woods or mixed (deciduous/coniferous) woods. It is also found in open woods, parks, and suburban areas. Habitat segregation is the principal factor that separates the Black-capped Chickadee from both the Boreal Chickadee in the north and the Chestnut-backed Chickadee in the Pacific northwest (these two species prefer strictly coniferous forests). Altitude also separates the Black-capped Chickadee from the (higher) Mountain Chickadee in the western mountains and the (lower) Carolina Chickadee in the Great Smokey Mountains.

Diet and foraging[edit]

Chickadees will take food such as seeds from feeders and trays over to a tree branch to hammer them open.

Insects (especially caterpillars) form a large part of their diet in summer. The birds hop along tree branches searching for food, sometimes hanging upside down or hovering; they may make short flights to catch insects in the air. Seeds and berries become more important in winter, though insect eggs and pupae remain on the menu. Black oil sunflower seeds are readily taken from bird feeders. The birds take a seed in their bill and commonly fly from the feeder to a tree, where they proceed to hammer the seed on a branch to open it.

Like many other species in the Paridae family, Black-capped chickadees commonly cache food, mostly seeds but sometimes insects also.[7] Items are stored singly in various sites such as bark, dead leaves, clusters of conifer needles, or knotholes. Memory for the location of caches can last up to 28 days.[8] Within the first 24 hours, the birds can even remember the relative quality of the stored items.[9]

At bird feeders, Black-capped Chickadees tolerate human approach to a much greater degree than do other species. In fact, during the winter, many individuals accustomed to human habitation will readily accept seed from a person's hand.

Chickadee at feeder.

Metabolism[edit]

On cold winter nights, these birds reduce their body temperature by as much as 10-12 °C (18-22 °F) (from their normal temperature of about 42 °C (108 °F)) to conserve energy.[10][11] Such a capacity for torpor is rare in birds (or at least, rarely studied). Other bird species capable of torpor include the Common Swift Apus apus, the Common Poor-will Phalaenoptilus nuttallii, the Lesser Nighthawk Chordeiles acutipennis, and various species of hummingbirds.

Movements[edit]

These birds are permanent residents, but sometimes they move south within their range, and even outside of it, in the fall or winter.

During the fall migration and in winter, chickadees often flock together. Many other species of birds – including titmice, nuthatches, and warblers – can often be found foraging in these flocks. Mixed flocks stay together because the chickadees call out whenever they find a good source of food. This calling-out forms cohesion for the group, allowing the other birds to find food more efficiently. When flocking, Black-capped Chickadees soon establish a rigid social hierarchy. In such hierarchies, males usually rank over females, and older birds over juveniles.

Body maintenance[edit]

Black-capped Chickadees sleep in thick vegetation or in cavities, usually singly, though there have been suggestions that they may occasionally roost clumped together.[12] The sleeping posture is with the bill tucked under the scapular (shoulder) feathers.

This bird scratches its head with its foot over the wing. It can bathe in water, dew, or snow; young chickadees have been observed dust-bathing.

Flight[edit]

Their flight is slightly undulating with rapid wing beats. Flight speed is about 20 km/h (12 mph).[13]

Vocalization[edit]

The vocalizations of the Black-capped Chickadee are highly complex.[14] Thirteen distinct types of vocalizations have been classified, many of which are complex and can communicate different types of information. Chickadees' complex vocalizations are likely an evolutionary adaptation to their habitat: they live and feed in dense vegetation, and even when the flock is close together, individual birds tend to be out of each other's visual range.

Black-capped Chickadee, Iona Beach Regional Park

The song of the Black-capped is a simple, clear whistle of two notes, identical in rhythm, the first roughly a whole-step above the second.[15] This is distinguished from the Carolina chickadee's four-note call fee-bee fee-bay; the lower notes are nearly identical but the higher fee notes are omitted, making the Black-capped song like bee bay.

Some 'gargles', then a minute of singing.

NOTE: American Robin singing in background.

Problems playing this file? See media help.

The males sing the song only in relative isolation from other chickadees (including their mates). In late summer, some young birds will sing only a single note. Both sexes sometimes make a faint version of the song, and this appears to be used when feeding young.

The most familiar call is the chick-a-dee-dee-dee which gave this bird its name. This simple-sounding call is astonishingly complex. It has been observed to consist of up to four distinct units which can be arranged in different patterns to communicate information about threats from predators and coordination of group movement. Recent study of the call shows that the number of dees indicates the level of threat from nearby predators. In an analysis of over 5,000 alarm calls from chickadees, it was found that alarm calls triggered by small, dangerous raptors had a shorter interval between chick and dee and tended to have extra dees, usually averaging four instead of two. In one case, a warning call about a pygmy owl – a prime threat to chickadees – contained 23 dees.[16] The Carolina Chickadee makes a similar call which is faster and higher-pitched.

There are a number of other calls and sounds that these Chickadees make, such as a gargle noise usually used by males to indicate a threat of attacking another male, often when feeding. This call is also used in sexual contexts. This noise is among the most complex of the calls, containing 2 to 9 of 14 distinct notes in one population that was studied.

Reproduction[edit]

The Black-capped Chickadee nests in a hole in a tree, 1–7 m (3.3–23.0 ft) above ground. The pair either excavate the hole together, or use a natural cavity, or sometimes an old woodpecker nest. This species will also nest in a nesting box. The nesting season is from late April through June. The nest is built by the female only. It consists of a base of coarse material such as moss or bark strips, and lining of finer material such as mammal hair. Eggs are white with fine dots of reddish brown concentrated at the larger end. On average, eggs are 1.52 cm × 1.22 cm (0.60 in × 0.48 in). Clutch size is 6–8 eggs. Incubation lasts 11–14 days and is by the female only, who is fed by the male. If there is an unusual disturbance at the nest entrance, the incubating female may utter an explosive hiss, like that of a snake, a probable adaptation to discourage nest predators.[17]

Hatchlings are altricial, naked with their eyes closed. Nestlings are fed by both sexes but are brooded by the female only (at which time the male brings food to her, which she passes on to the young). Young leave the nest 12–16 days post-hatching, in great part because the parents start presenting food only outside the nest hole. The young will still be fed by the parents for several weeks but are capable of catching food on their own within a week after leaving the nest.

Black-capped Chickadees usually breed only once a year, but second broods are possible if the first one is lost. First breeding is at one year of age. Maximum recorded lifespan is twelve years, but most individuals live only half that long.[18]

Black-capped Chickadees are socially monogamous, and males contribute greatly to reproduction. During the laying and incubation periods, males feed their partners extensively. When the nestlings hatch, males are the primary providers. However, as the nestlings grow, females become the main caretakers. Females prefer dominant males, and greater reproductive success is closely related to the higher ranking of the male.[19]

Black-capped Chickadees may interbreed with Carolina Chickadees or Mountain Chickadees where their ranges overlap. It appears to be more rare, but interbreeding with Boreal Chickadees has also been documented.[20]

Dominance hierarchy[edit]

During the winter, Poecile atricapillus form flocks through which dominance hierarchies can be easily observed. Dominance hierarchies play an important role in determining the social behaviors among the birds in these flocks. Positive correlates to higher social rankings include territory size, body condition, singing rate, and reproductive success.[21] The hierarchies are linear and stable; once a relationship is established between two birds, it stays the same for many years. In general, older and more experienced birds are dominant over younger individuals, and males are dominant over females.[22] Dominant and subordinate members differ in their foraging strategies and risk taking behaviors. Dominant individuals control access to preferred resources and restrict subordinates to foraging in novel, riskier or suboptimal environments. Subordinate individuals are often observed foraging in the outermost tree parts that are more prone to predators, while dominant individuals forage low and close to the tree trunk. In experiments, subordinate individuals display less neophobic when approaching novel foods and objects, compared to their dominant counterparts. Subordinate individuals are also more likely to enter novel environment than their dominant counterparts. This is similar to subordinate primates who feed on novel food more readily than the dominant individuals because they are more used to eating suboptimal and unfamiliar food. There is no difference observed in ability to learn novel foraging tasks between dominant and subordinate individuals.[23]

State and provincial bird[edit]

The Black-capped Chickadee is the state bird of Maine and Massachusetts and the provincial bird of New Brunswick.

Concerns[edit]

In the states of Alaska and Washington, and in parts of western Canada, Black-capped Chickadees are among a number of bird species affected by an unknown agent that is causing beak deformities which may cause stress for affected species by inhibiting feeding ability, mating, and grooming. Black-capped Chickadees were the first affected bird species, with reports of the deformity beginning in Alaska in the late 1990s, but more recently the deformity has been observed in close to 30 bird species in the affected areas.[24]

References[edit]

  1. ^ BirdLife International (2012). "Parus atricapillus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Gill, F. B.; Slikas, B.; Sheldon, F. H. (2005). "Phylogeny of titmice (Paridae): II. Species relationships based on sequences of the mitochondrial cytochrome-b gene" (PDF). Auk 122: 121–143. doi:10.1642/0004-8038(2005)122[0121:POTPIS]2.0.CO;2. 
  3. ^ Del Hoyo, J., Elliot, A., & Christie D. (eds). (2007). Handbook of the Birds of the World. Volume 12: Picathartes to Tits and Chickadees. Barcelona: Lynx Edicions. ISBN 978-84-96553-42-2
  4. ^ — Species — Birds of North America Online. Bna.birds.cornell.edu. Retrieved on 2013-03-23.
  5. ^ Black-capped Chickadee, Life History, All About Birds – Cornell Lab of Ornithology. Allaboutbirds.org. Retrieved on 2013-03-23.
  6. ^ Tricky Bird IDs: Black-capped and Carolina chickadees. Birds.cornell.edu. Retrieved on 2013-03-23.
  7. ^ Heinrich, Bernd; Collins, Scott L. (June 1983). "Caterpillar Leaf Damage, and the Game of Hide-and-seek with Birds". Ecology 64 (3). doi:10.2307/1939978. JSTOR 1939978. 
  8. ^ Hitchcock, C. L.; Sherry, D. F. (1990). "Long-term memory for cache sites in the Black-capped Chickadee". Animal Behaviour 40 (4): 701. doi:10.1016/S0003-3472(05)80699-2. 
  9. ^ Sherry, D. F. (1984). "Food storage by the Black-capped Chickadee: memory for the location and contents of caches". Animal Behaviour 32 (2): 451. doi:10.1016/S0003-3472(84)80281-X. 
  10. ^ Chaplin, S. B. (1974). "Daily energetics of the Black-capped Chickadee, Parus atricapillus, in winter". Journal of Comparative Physiology 89 (4): 321. doi:10.1007/BF00695350. 
  11. ^ Chaplin, S. B. (1976). "The physiology of hypothermia in the Black-capped Chickadee Parus atricapillus". Journal of Comparative Physiology B 112 (3): 335. doi:10.1007/BF00692303. 
  12. ^ Loery, G.; Nichols, J. D. (1985). "Dynamics of a Black-capped Chickadee population, 1958–1983". Ecology 66: 1195–1203. doi:10.2307/1939172. JSTOR 1939172. 
  13. ^ Greenewalt, C. H. (1955). "The flight of the Black-capped Chickadee and the White-breated Nuthatch". Auk 72 (1): 1–5. doi:10.2307/4081384. 
  14. ^ Ficken, M. S.; Ficken, R. W.; Witkin, S. R. (1978). "Vocal repertoire of the Black-capped Chickadee" (PDF). Auk 95 (1): 34–48. doi:10.2307/4085493. 
  15. ^ Jackson, Dave (24 March 2010). "Olympic Peninsula Audubon Society". Olympic Peninsula Audubon Society. Retrieved 2012-03-13. 
  16. ^ Templeton, C. N.; Greene, E.; Davis, K. (2005). "Allometry of alarm calls: black-capped chickadees encode information about predator size". Science 308 (5730): 1934–7. doi:10.1126/science.1108841. PMID 15976305. 
  17. ^ Forbush, E.H. (1925-29) Birds of Massachusetts and other New England states. Mass. Dept. of Agriculture, Boston.
  18. ^ Löf, R. A. (1967). "Ten years of banding black-capped chickadees". EBBA News 30: 195–198. 
  19. ^ Oort, Harry Van; Otter, Kenneth A.; Fort, Kevin T.; Mcdonell, Zoe (2007). "Habitat, Dominance, And The Phenotypic Quality Of Male Black-Capped Chickadees". The Condor 109 (1): 88. 
  20. ^ Lait, Linda; Lauff, R. F.; Burg, T. M. (2012). "Genetic evidence supports Boreal Chickadee (Poecile hudsonicus) x Black-capped Chickadee (Poecile atricapillus) hybridization in Atlantic Canada". The Canadian Field-Naturalist 126: 143. 
  21. ^ An, Yong Seok; Kriengwatana, Buddhamas; Newman, Amy E.; Macdougall-Shackleton, Scott A.; Macdougall-Shackleton (2011). "Social Rank, Neophobia and Observational Learning in Black-capped Chickadees". Behavior 148 (1): 55-69. 
  22. ^ Oort, Harry Van; Otter, Kenneth A.; Fort, Kevin T.; Mcdonell, Zoe (2007). "Habitat, Dominance, And The Phenotypic Quality Of Male Black-Capped Chickadees". The Condor 109 (1): 88. 
  23. ^ An, Yong Seok; Kriengwatana, Buddhamas; Newman, Amy E.; Macdougall-Shackleton, Scott A.; Macdougall-Shackleton (2011). "Social Rank, Neophobia and Observational Learning in Black-capped Chickadees". Behavior 148 (1): 55-69. 
  24. ^ Beak Deformities. Alaska Science Center of the United States Geological Survey. Alaska.usgs.gov (15 February 2013). Retrieved on 2013-03-23.

Further reading[edit]

  • Smith, S. M. (1991): The black-capped Chickadee: Behavioural Ecology and Natural History. Cornell University Press. ISBN 0-8014-2382-1 (1991 reprint).
  • Smith, S. M., 1993, Black-capped Chickadee. In The Birds of North America, no. 39 (A. Poole, P. Stettenheim and F. Gill, eds.) Philadelphia: The Academy of Natural Sciences.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

The currently accepted scientific name for the black-capped chickadee is
Poecile atricapillus Linnaeus [2]. The 1957 A.O.U. checklist [1] (the
last one that included subspecies) listed nine subspecies of the
black-capped chickadee:

Poecile atricapillus atricapillus, eastern black-capped chickadee
P. a. practicus (Oberholser), Appalachian black-capped chickadee
P. a. bartletti Aldrich and Nutt., Newfoundland black-capped chickadee
P. a. turneri Ridgway, Yukon black-capped chickadee
P. a. septentrionalis Harris, long-tailed chickadee
P. a. occidentalis Baird, Oregon chickadee
P. a. fortuitus (Dawson and Bowles), Columbian black-capped chickadee
P. a. nevadensis (Linsdale), pallid black-capped chickadee
P. a. garrinus Behle, Rocky Mountain black-capped chickadee

Where the range of the black-capped chickadee overlaps that of other
chickadees (Poecile spp.) they are segregated by habitat. There are some
areas of breeding territory which the black-capped chickadee and the
Carolina chickadee (P. carolinensis) both use; in this area hybrids of
the two species commonly occur. There is some disagreement as to the
true status of the Carolina chickadee; it has been argued that it is a
subspecies of the black-capped chickadee rather than a separate species.
The most recent genetic evidence suggests that they are in fact separate
species. Hybrids with the mountain chickadee (P. gambeli) have also
been reported but are less common than black-capped chickadee-Carolina
chickadee hybrids [30].
  • 1. American Ornithologists' Union. 1957. Checklist of North American birds. 5th ed. Baltimore, MD: The Lord Baltimore Press, Inc. 691 p. [21235]
  • 30. Smith, Susan M. 1991. The black-capped chickadee: behavioral ecology and natural history. Ithaca, NY: Cornell Univ. Press. [Pages unknown]
  • 2. American Ornithologists' Union. 2004. The A.O.U. check-list of North American birds, 7th edition, [Online]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common Names

black-capped chickadee

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Formerly in genus Parus but transferred to Poecile by AOU (1997); subsequently endings of ATRICAPILLUS and PRACTICUS were feminized to ATRICAPILLA and PRACTICA to agree with feminine Poecile (AOU 2000). See DeBenedictis (1987, Birding 19:42-45) for review of hybridization between Carolinensis and P. ATRICAPILLA; the two taxa hybridize freely wherever they meet and easily could be regarded as conspecific. P. ATRICAPILLA exhibits little mtDNA genetic differentiation throughout the previously glaciated continental distribution; in general, mtDNA variation corresponds only weakly with subspecies designations; Newfoundland populations have distinct mtDNA haplotypes that differ from continental haplotypes by single restriction site changes (Gill et al. 1993). Phylogenetic analyses indicate that North American chickadees comprise two clades, P. HUDSONICA-RUFESCENS-SCLATERI versus P. CAROLINENSIS-ATRICAPILLA-GAMBELI, and that Carolinensis and P. ATRICAPILLA are not sister species (Gill et al. 1993). See Sheldon et al. (1992) for DNA-DNA hybridization evidence of phylogenetic relationships among major lineages of Parus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Original Classification

Origionally Linnaeus described Poecile atricapillus in 1766 as being in the genus Parus, after which it was moved to the genus Poecile.

  • Linné, C. a 1766. Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio duodecima, reformata. - pp. 1-532. Holmiæ. (Salvius).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Lorenzo Katin-Grazzini

Supplier: Lorenzo Katin-Grazzini

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!