Articles on this page are available in 1 other language: Chinese (Simplified) (5) (learn more)

Overview

Comprehensive Description

The Pacific Golden Plover is a slender upright shorebird (wader), with a rounded head, slim neck, short fine bill and long legs. It has large eyes. In breeding plumage, the underparts from the tail to the chin including the eye are black with white flecking on the tail. The upperparts, crown and wings are golden brown with white and black flecks on the wings. A continuous white flank line separates the upper and underparts, running from above the eye back to the tail, and black flecking is visible under the wing. When not breeding, it has a broad, buff brown to white eyebrow and the upperparts are duller, being golden brown with white spots and the underparts are brown to light grey. Young birds are similar to non-breeding adults but the breast is mottled brownish-yellow and grey-brown and the birds have a light yellow eyebrow. The Pacific Golden Plover is also know as the Eastern, Lesser or Least Golden Plover. Voice: Clear and melodic: ""Quee""

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDING: western Alaska east to Yamal Peninsula in Siberia. NON-BREEDING: India, southern China, Hawaii (most abundant August-April, some present all year) south to Australia, New Zealand. Breeders from western Alaska and eastern Siberia occur mainly in the Indo-Pacific region during the northern winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Siberia and w Alaska; winters to Africa, s Asia and Australasia.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution:


    NC & NE Russia, from Yamal Peninsula to Chukotskiy Peninsula and S across Koryakskiy highlands to N Kamchatka; W Alaska. Winters from E Africa through S Asia and Indonesia to Oceania, Australia and New Zealand; small numbers in S California.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 27 cm

Weight: 145 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

23-26 cm

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The Pacific Golden Plover is a slender upright shorebird (wader), with a rounded head, slim neck, short fine bill and long legs. It has large eyes. In breeding plumage, the underparts from the tail to the chin including the eye are black with white flecking on the tail. The upperparts, crown and wings are golden brown with white and black flecks on the wings. A continuous white flank line separates the upper and underparts, running from above the eye back to the tail, and black flecking is visible under the wing. When not breeding, it has a broad, buff brown to white eyebrow and the upperparts are duller, being golden brown with white spots and the underparts are brown to light grey. Young birds are similar to non-breeding adults but the breast is mottled brownish-yellow and grey-brown and the birds have a light yellow eyebrow. The Pacific Golden Plover is also know as the Eastern, Lesser or Least Golden Plover. Voice: Clear and melodic: ""Quee""

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour This species is strongly migratory, with different populations travelling on narrow or broad fronts depending on the location of their breeding and wintering grounds (del Hoyo et al. 1996). The species breeds between June and July (Hayman et al. 1986) after which it departs the breeding grounds from late-August or early-September (del Hoyo et al. 1996). It may forage singly or in flocks of one hundred or more individiuals, occurring in small groups of 3-7 individuals at stopover sites on the northward passage but in large flocks on the southward passage (del Hoyo et al. 1996). Habitat Breeding It breeds on inland Arctic habitats including shrub tundra, montane tundra and stony well-drained uplands with mosses and lichens (del Hoyo et al. 1996). Non-breeding The species occurs on the shores of lakes and rivers when on passage in the U.S.S.R. (Hayman et al. 1986), but outside of the breeding season in generally occupies coastal areas, foraging in coastal fields and prairies with short grass, ploughed fields (del Hoyo et al. 1996), coastal freshwater pools (Hayman et al. 1986), saltmarshes, beaches, open mud and sandflats (del Hoyo et al. 1996) and reefs (Hayman et al. 1986). It roosts on the same habitats used for foraging, as well as on exposed sandy beaches and exposed rocks (del Hoyo et al. 1996). Diet Its diet consists predominantly of insects, molluscs, worms, crustaceans and spiders, although berries are also important during the breeding season on the Arctic tundra (del Hoyo et al. 1996). Breeding site The nest is a shallow scrape positioned on a dry site amongst hummocks, lichen, Dryas spp. or moss (del Hoyo et al. 1996). The species shows a high degree of nest-site fidelity and will return to the same nest cup or to within 100 m of nest-site of previous year (del Hoyo et al. 1996).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Grassy arctic and alpine tundra, usually in areas at lower elevation, in denser and taller vegetative cover than used by P. DOMINICA (breeding). Nests on grassy tundra; prefers dry upland areas. The nest is a shallow scraped-out depression, lined with mosses, leaves, grass, and lichens. In western Alaska, where DOMINICA and FULVA are sympatric, DOMINICA nests occurred more often in areas of higher elevation and slope, with sparser and shorter vegetation, and more rocks; FULVA nests were usually at lower elevations in denser and taller vegetative cover; both forms used relatively dry upland tundra (Connors et al. 1993). In western Alaska (P. FULVA), males returned to the same nesting territories in successive years; most females did not (Johnson et al. 1993). NON-BREEDING: short-grass prairie, pastures, mudflats, sandy beaches, and flooded fields.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Pacific Golden Plover is found on muddy, rocky and sandy wetlands, shores, paddocks, saltmarsh, coastal golf courses, estuaries and lagoons.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in Hawaii by August, departs by late April; indirect and direct evidence indicate that birds in Hawaii in winter are from Alaskan breeding areas (Johnson et al. 1989, Johnson et al. 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds primarily on insects (grasshoppers, crickets, grubs of beetles, caterpillars, cutworms, wireworms, etc.). Also eats some small mollusks and crustaceans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eats molluscs, insects, worms, crustaceans, lizards and is known to eat birds' eggs and small fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: Morrison et al. (2001) give a global estimate of 125,000 individuals. Fall counts from three sites in Alaska total 15,900 (Gill et al. 1999); Morrison et al. (2001) estimate a North American population of 16,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

NON-BREEDING: In Hawaii, many establish winter territories to which they return each year; abandon territories at night and roost in flock (Johnson et al. 1981). Territorial birds had higher apparent survival rates than non-territorial wintering birds (Johnson et al. 2001). Winter mortality in Hawaii was caused by accidents (collisions) and probable predation by owls (Johnson et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals. Record longevity from banding studies is 8.5 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm). Considering the longevity of similar species, however, maximum longevity could be significantly underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding begins in late spring. Clutch size usually 4. Incubation probably about 26 days, by both sexes. Young precocial, tended by both adults. Monogamous. First breeds at 1 year, though first-year females may breed less commonly than do first-year males (Johnson et al. 1993). Nesting density and/or nesting success may vary greatly over time and space (Johnson et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in Alaska in June and July.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pluvialis fulva

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTCGGCGCATGAGCCGGTATAGTCGGCACCGCCCTTAGCTTACTCATCCGCGCAGAACTTGGCCAACCAGGTACCCTACTAGGAGATGACCAAATCTACAATGTAATTGTTACTGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATGATTGGAGGCTTCGGAAACTGACTAGTACCCCTCATAATTGGTGCCCCCGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCATTCCTACTTCTCCTTGCCTCCTCCACAGTAGAAGCCGGAGCAGGCACAGGATGAACCGTATACCCCCCTCTAGCTGGTAACCTAGCTCACGCCGGAGCCTCAGTAGACCTGGCTATTTTTTCCCTCCACCTAGCAGGTGTATCCTCAATCCTAGGTGCAATCAACTTCATCACAACCGCCATCAATATAAAACCTCCTGCCCTATCACAATACCAAACTCCCCTATTTGTATGATCCGTACTCATCACTGCCGTCCTACTGCTCCTTTCACTCCCAGTTCTTGCTGCTGGCATCACCATACTATTAACAGACCGAAACCTAAACACCACATTCTTCGACCCTGCCGGAGGCGGAGACCCAGTCCTATATCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pluvialis fulva

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4M - Apparently Secure

United States

Rounded National Status Rank: N5B,NNRN : N5B: Secure - Breeding, NNRN: Unranked - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© New Guinea Birds

Source: Birds of Papua New Guinea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.190,000-250,000 individuals (Wetlands International 2006), while national population sizes have been estimated at c.1,000-10,000 individuals on migration and c.1,000-10,000 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pacific golden plover

The Pacific golden plover (Pluvialis fulva) is a medium-sized plover.

The 23–26 cm long breeding adult is spotted gold and black on the crown, back and wings. Its face and neck are black with a white border and it has a black breast and a dark rump. The legs are black. In winter, the black is lost and the plover then has a yellowish face and breast, and white underparts.

It is similar to two other golden plovers, Eurasian and American. Pacific golden plover is smaller, slimmer and relatively longer-legged than European golden plover, Pluvialis apricaria, which also has white axillary (armpit) feathers. It is more similar to American golden plover, Pluvialis dominica, with which it was once considered conspecific (as "lesser golden plover", see Sangster et al., 2002). The Pacific golden plover is slimmer than the American species, has a shorter primary projection, and longer legs, and is usually yellower on the back.

The breeding habitat of Pacific golden plover is Arctic tundra from northernmost Asia into western Alaska. It nests on the ground in a dry open area.

This wader is migratory and winters in south Asia and Australasia. A few winter in California and Hawaii, USA. In Hawaii, the bird is known as the kolea. It is a very rare vagrant to western Europe.

This bird forages for food on tundra, fields, beaches and tidal flats, usually by sight. It eats insects and crustaceans and some berries.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: P. dominica and P. fulva formerly were regarded as conspecific (P. dominica). Connors et al. (1993) documented clear and consistent differences in breeding vocalizations and nesting habitat, and strict assortative mating in areas of sympatry in western Alaska; they concluded that P. dominica and P. fulva are distinct species. Sibley and Monroe (1990) and AOU (1993) also treated these taxa as separate species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!