Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Motacilla citreola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTATACCTAATTTTTGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTTATTCGAGCAGAACTAGGTCAACCCGGAGCCCTCCTAGGAGACGACCAAGTCTACAATGTAGTCGTTACTGCTCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCCATTATAATCGGGGGATTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCTCCAGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTACTACCCCCATCCTTCCTCCTCCTGCTAGCATCATCTACAGTTGAAGCAGGAGCAGGCACAGGCTGAACCGTGTACCCTCCACTAGCTGGCAACCTAGCCCACGCCGGAGCTTCAGTCGACCTGGCAATTTTCTCCCTACACCTAGCTGGTATCTCTTCAATTCTAGGTGCAATCAACTTCATTACAACAGCAATTAACATAAAACCTCCTGCCCTCTCACAATATCAAACCCCACTATTCGTTTGATCAGTCCTAATCACCGCAGTCCTACTGCTACTCTCTCTACCAGTACTAGCTGCTGGTATCACAATGCTCCTCACAGACCGTAACCTCAACACTACATTCTTTGACCCTGCAGGAGGAGGAGACCCTGTTTTATATCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTCTACATCTTAATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Motacilla citreola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 210000-520000 breeding pairs, equating to 630000-1560000 individuals (BirdLife International 2004). Europe forms 5-24% of the global range, so a very preliminary estimate of the global population size is 2630000-31200000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Citrine Wagtail

The Citrine Wagtail or Yellow-headed Wagtail (Motacilla citreola) is a small songbird in the family Motacillidae. The term citrine refers to its yellowish colouration. Its systematics, phylogeny and taxonomy are subject of considerable debate in the early 21st century. This is because this bird forms a cryptic species complex with the Eastern (M. tschutschensis ) and Western Yellow Wagtail (M. flava). Which of the many taxa in this group should properly refer to which population is unlikely to be resolved in the immediate future.[2]

It is a slender, 15.5–17 cm long bird, with the long, constantly wagging tail characteristic of the genus Motacilla. The adult male in breeding plumage is basically grey or black above, with white on the remiges, and bright yellow below and on the entire head except for the black nape. In winter plumage, its yellow underparts may be diluted by white, and the head is brownish with a yellowish supercilium. Females look generally like washed-out versions of males in winter plumage.

This species breeds in north central Asia in wet meadows and tundra. It migrates in winter to south Asia, often to highland areas. Its range is expanding westwards, and it is a rare but increasing vagrant to western Europe. Vagrants seem to extend the migration rather than straying en route; in Bhutan for example, though along one of the species' migration flyways, the Citrine Wagtail has been recorded as an extremely rare passer-by rather than staying even for a few days or weeks[3].

It is an insectivorous bird of open country near water, such as wet meadows and bogs, and nests on the ground, laying 4–5 speckled eggs.

References

Media related to Motacilla citreola at Wikimedia Commons

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!