Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Behaviour North-Asian populations of this species are fully migratory, leaving Japan in September-October to winter in the Philippines and Borneo (Kushlan and Hancock 2005), and returning to breeding colonies in April (del hoyo et al. 1992). The majority is predominantly sedentary however, with some populations making limited nomadic or partially migratory movements (Brown et al. 1982) in response to changing water levels (Hockey et al. 2005). The breeding season varies regionally (del hoyo et al. 1992), but is usually centered around the wet season (Kushlan and Hancock 2005), with birds breeding in mixed-species colonies (del hoyo et al. 1992) of between 7, 20 (Hockey et al. 2005) and hundreds of pairs (sometimes up to thousands) (Marchant and Higgins 1990). The species is diurnal (del hoyo et al. 1992, Kushlan and Hancock 2005) and usually feeds singly, but old records suggest (Kushlan and Hancock 2005) that it may form flocks of 15-20 individuals (sometimes up to 250) (Brown et al. 1982, del hoyo et al. 1992), occasionally forming concentrations around permanent water during droughts (Kushlan and Hancock 2005). During the night the species roosts communally in trees over water (del hoyo et al. 1992, Hockey et al. 2005) in groups of 20 or more (Marchant and Higgins 1990). Habitat The species inhabits lowlands from sea-level to 1,000 m in Sumatra, and 1,450 m in Nepal (del hoyo et al. 1992). It shows a preference for sheltered flood-plains and seasonal wetlands with water less than 80 mm deep and emergent grasses, herbs, sedges, reeds or rushes and abundant aquatic vegetation (Marchant and Higgins 1990) (generally avoiding areas where vegetation is too thick for feeding) (Kushlan and Hancock 2005). Such habitats include seasonally flooded marshes, inland deltas (e.g. Okavango Basin, Botswana) (Hockey et al. 2005), ponds, swamp forest (Kushlan and Hancock 2005), freshwater swamps, pools, rivers, streams, rice-fields, the margins of freshwater, brackish and saltwater lakes (Brown et al. 1982, del hoyo et al. 1992, Kushlan and Hancock 2005), wet meadows, and flooded and dry pasture near water (Brown et al. 1982, del hoyo et al. 1992, Hockey et al. 2005, Kushlan and Hancock 2005). It occurs less often in coastal habitats, but may roost in mangrove swamps (Hancock and Kushlan 1984, del hoyo et al. 1992), and frequents mudflats, tidal estuaries (del hoyo et al. 1992), coastal lagoons (Brown et al. 1982), saltmarshes, and tidal streams and rivers (Marchant and Higgins 1990, Kushlan and Hancock 2005). Diet In aquatic habitats the diet of this species consists predominantly of fish less than 10 cm long (del hoyo et al. 1992, Hockey et al. 2005) (including eels, perch Macquaria, gudgeon and mosquitofish Gambusia) (Kushlan and Hancock 2005), as well as frogs, crustaceans (e.g. crayfish) (del hoyo et al. 1992, Hockey et al. 2005, Kushlan and Hancock 2005) and aquatic insects (e.g. leeches, water bugs and dragonfly larvae) (del hoyo et al. 1992, Hockey et al. 2005, Kushlan and Hancock 2005). It will also take terrestrial prey in drier habitats (Kushlan and Hancock 2005) including grasshoppers (del hoyo et al. 1992, Hockey et al. 2005), mole crickets, bugs and beetles, snakes (Kushlan and Hancock 2005), spiders (del hoyo et al. 1992, Hockey et al. 2005, Kushlan and Hancock 2005) lizards (del hoyo et al. 1992, Kushlan and Hancock 2005), and exceptionally birds (del hoyo et al. 1992). Breeding site The species breeds colonially with other species (del hoyo et al. 1992) but does not concentrate into dense groups; individual nests being typically situated 0.5 m away from each other (Marchant and Higgins 1990). The nest is a shallow platform of sticks and other marshland vegetation (Brown et al. 1982, Hockey et al. 2005, Kushlan and Hancock 2005) usually positioned in trees standing in water or over reedbeds (Brown et al. 1982, Marchant and Higgins 1990) (e.g. in inland swamps or mangroves) (Kushlan and Hancock 2005), at heights of 3-6 m and occasionally up to 20 m (del hoyo et al. 1992). The species may also nest on ledges, in reedbeds or in bushes (Brown et al. 1982).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mesophoyx intermedia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATCTTTGGGGCATGAGCTGGCATAATTGGAACTGCCCTAAGCCTACTCATCCGAGCTGAACTTGGCCAACCAGGAACACTCCTAGGAGAC---GACCAAATCTACAATGTAATCGTCACTGCCCATGCCTTCGTAATAATCTTCTTTATAGTCATGCCAATCATAATTGGAGGCTTCGGAAATTGACTAGTCCCGCTTATAATTGGGGCCCCAGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTCCTACCACCATCATTCATACTCCTCCTAGCTTCATCCACGGTCGAAGCAGGAGCAGGTACAGGCTGAACAGTCTACCCACCATTAGCTGGTAACCTGGCTCATGCTGGAGCCTCAGTAGACCTGGCCATCTTCTCCCTTCACCTAGCAGGTGTATCTTCCATTCTAGGGGCAATTAACTTCATTACAACTGCCATCAACATAAAACCTCCAGCCCTATCACAATATCAAACCCCCCTATTCGTATGGTCTGTCCTAATTACTGCTGTCTTACTCTTACTCTCACTCCCAGTCCTTGCCGCAGGCATTACAATACTACTGACCGACCGAAACCTAAACACCACATTCTTTGACCCTGCTGGAGGCGGCGACCCAGTTCTCTACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTCCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mesophoyx intermedia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population is estimated to number c.180,000-1,300,000 individuals (Wetlands International 2006), while national population estimates include: c.10,000-100,000 breeding pairs, c.1,000-10,000 individuals on migration and c.1,000-10,000 wintering individuals in China; < c.100 breeding pairs and c.1,000-10,000 wintering individuals in Taiwan; c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and < c.50 wintering individuals in Korea and c.10,000-100,000 breeding pairs, c.1,000-10,000 individuals on migration and < c.50 wintering individuals in Japan (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species has declined markedly in Japan since the 1960s due to pollution and the disturbance of nesting colonies (Hancock and Kushlan 1984, del hoyo et al. 1992). The species is also threatened in the Northern Territory of Australia by the degradation of flood-plain habitats owing to grazing, burning, invasion by introduced plants (Marchant and Higgins 1990) (particularly Mimosa pigra and Salvinia molesta (Maddock 2000)), reduced water flows from drainage and water diversion for irrigation (Marchant and Higgins 1990, McKilligan 2005), levee breaking by feral buffalo (Marchant and Higgins 1990, Maddock 2000) (allowing salt intrusion and accumulation of tidal sediment (Marchant and Higgins 1990)), clearing of swamp forest, and pollution from mineral extraction (Maddock 2000). Utilisation This species is hunted and traded at traditional medicine markets in Nigeria (Nikolaus 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Intermediate Egret

The intermediate egret, median egret,[2] smaller egret,[3] or yellow-billed egret (Mesophoyx intermedia) is a medium-sized heron. Some taxonomists put the species in the genus Egretta or Ardea. It is a resident breeder from east Africa across the Indian subcontinent to Southeast Asia and Australia.

Description[edit]

This species, as its scientific name implies, is intermediate in size between the great egret and smaller white egrets like the little egret and cattle egret, though nearer to little than great. It is about 56–72 cm (22–28 in) long with a 105–115 cm (41–45 in) wingspan and weighs c.400g (14 oz),[4] with all-white plumage, generally dark legs and a thickish yellow bill. Breeding birds may have a reddish or black bill, greenish yellow gape skin, loose filamentous plumes on their breast and back, and dull yellow or pink on their upper legs (regional variations). The sexes are similar.

Differences from great egret[edit]

Sketch comparing gapes of intermediate and great egrets

The non-breeding colours are similar, but the intermediate is smaller, with neck length a little less than body length, a slightly domed head, and a shorter, thicker bill. The great egret has a noticeable kink near the middle of its neck, and the top of its longer bill nearly aligns with the flat top of its head. Close up, the bare skin of the great egret's gape line extends in a dagger shape behind the eye, while the Intermediate's is less pointed and ends below the eye. The intermediate tends to stalk upright with neck extended forward. The great is more patient, often adopting a sideways-leaning "one-eyed" stance.

Differences from little egret[edit]

Little egrets have yellow-soled feet and black bills. They often run after fish in shallow water. Breeding birds have long nuptial plumes on the back of their heads.

Behaviour[edit]

The intermediate egret stalks its prey methodically in shallow coastal or fresh water, including flooded fields. It eats fish, frogs, crustaceans and insects. It often nests in colonies with other herons, usually on platforms of sticks in trees or shrubs. Two to five eggs are laid, the clutch size varying with region.

In Northern Territory, Australia

References[edit]

  1. ^ BirdLife International (2012). "Mesophoyx intermedia". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Grewal, Bikram; Bill Harvey and Otto Pfister (2002). Photographic guide to birds of India. Hong Kong: Periplus editions. 
  3. ^ Ali, S. (1993). The Book of Indian Birds (11 revised ed.). Bombay: Bombay Natural History Society/Oxford University Press. ISBN 0195621670. 
  4. ^ del Hoyo,J., Elliott, A. and Sargatal, J. (1992). Handbook of the Birds of the World. Volume 1: Ostrich to Ducks. Lynx Edicions, Barcelona.

Other references[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!